Православие и атеизм => Наука и религия => Тема начата: Игорь Соколов от 11.01.2020, 22:23:59

Название: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 11.01.2020, 22:23:59
Существуют ли научные разработки таких критериев? Кто-то в учёном сообществе этим занимался?

Прошу не брать в рассмотрение "не уменьшаемую сложность систем", так как это частный случай для некоторых узких био-систем и не работает как универсальный критерий для других объектов.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 12.01.2020, 09:43:02
  Наш колектив НИИ ФХП работал успешно над этим. Вобщем после серии экспериментов мы пришли к выводу. Оказывается для т.н. "искусственных объектов" естественно быть неживыми. 
После чего мы посовещались и я решил что живой объект нельзя в принципе создать искуственно , он может появиться только случайно.    Ну а критерии живого и неживого однозначны и недвусмысленны . Вот , может пригодиться.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 12.01.2020, 09:43:48
 p.s. Эксперименты проводились в НИИ физико-химических проблем на кафедре высокомолекулярных соединений. В рамках проекта "т.н. искусственная мышца" .
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 12.01.2020, 20:07:25
  Наш колектив НИИ ФХП работал успешно над этим.
Вобщем после серии экспериментов мы пришли к выводу. Оказывается для т.н. "искусственных объектов" естественно быть неживыми. 
Работали над критериями искусственности? Какие эксперименты проводили в этом плане? Какой эксперимент доказал, что искусственным быть естественно "мертвым"? Слово "естественно" в паре с "искусственным" явно лишнее, ведь искусственно заложенные свойства в объекте, как раз и определяют каким ему быть. 

После чего мы посовещались и я решил что живой объект нельзя в принципе создать искуственно , он может появиться только случайно.    Ну а критерии живого и неживого однозначны и недвусмысленны . Вот , может пригодиться.
Однако последние достижения науки опровергают эти выводы - созданные искусственно органы из стволовых клеток подпадают под критерий "живых". И это не случайность их создала, а целенаправленная разумная деятельность.

 
Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 12.01.2020, 21:08:31
Существуют ли научные разработки таких критериев? Кто-то в учёном сообществе этим занимался?

Прошу не брать в рассмотрение "не уменьшаемую сложность систем", так как это частный случай для некоторых узких био-систем и не работает как универсальный критерий для других объектов.

А если просто определение использовать ?

искусственный - созданный или осуществляемый человеком наподобие или вместо природного, подлинного.

естественный - образовавшийся или происходящий в природе, без участия или влияния человека.



Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 12.01.2020, 21:29:15
А если просто определение использовать ?

искусственный - созданный или осуществляемый человеком наподобие или вместо природного, подлинного.

естественный - образовавшийся или происходящий в природе, без участия или влияния человека.
Это устаревшее или не полное или даже не верное определение. Вместо человека ведь может быть и другое существо, например птица, которая свила гнездо. Гнездо, плотина бобра, муравейник - искусственные объекты. Или предположить, что есть объекты, созданные инопланетянами. Это уже некий разумный источник, отличный от человеческого.

Какие есть критерии, определяющие, что некий объёкт сделан разумом, не важно каким - человеческим или нечеловеческим?

Уже вывели одно определение - искусственный это объект, созданный разумом, или любым живым существом.

Какие критерии скажут, что объект искусственный?
Название: Re: Критерии искусственности объекта.
Отправлено: р.Б.Константин от 12.01.2020, 23:00:16
Универсального критерия, необходимого признака искусственности не существует. Например, исходя из вашего определения искусственности, кислород на Земле - в значительной степени искусственного происхождения. И практически вся органика ("создана разумом или любым живым существом").

Так что если нет четкости в понятии "искусственности", о каких критериях можно говорить?

Тем не менее, именно сложность системы, информационная система - кандидаты в достаточные признаки искусственности. В том смысле, в каком амёба сложнее галактики.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 13.01.2020, 11:33:24
Работали над критериями искусственности? Слово "естественно" в паре с "искусственным" явно лишнее, ведь искусственно заложенные свойства в объекте, как раз и определяют каким ему быть. 
 

  Это основной момент. Уточнить предмет разговора. Если природная "болванка" это неравновесная система (например стволовая клетка) , то на основе её  можно создать тоже неравновесную систему (печень). Если "болванка" суть  равновесная система  ( белковый бульон)  , то создать печень принципиально не возможно.
 
Живая система  это неравновесная термодинамическая система , для которой естественно находиться в неравновесном состоянии. Свободная энергия Гиббса в этой системе всё время "уводит" систему от состояния равновесия (от смерти). После прихода такой систему к состоянию равновесия (неестественному своему состоянию) её нельзя вновь вернуть в неравновесное состояние. Равновесное состояние для неё неестественно.

  Т.о. необходимым (но не достаточным)  критерием искусственности можно считать способность системы пребывать в равновесном состоянии сколь угодно долго , без ущерба для себя. Например работающую машину (неравновнсное состояние) можно остановить (равновесное состояние) , потом опять запустить. Равновесное состояние доя такой системы естественно. Неравновесное неестественно.

 ***

Но поскольку мы живём в мире-перевёртыше , то вывод напрашивается однозначный.  Жизнь неестественна для нашей вселенной. Она искусственна. Смерть естественна.

 

 
 

 
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 13.01.2020, 11:43:33
  Это основной момент. Уточнить предмет разговора. Если природная "болванка" это неравновесная система (например стволовая клетка) , то на основе её  можно создать тоже неравновесную систему (печень). Если "болванка" суть  равновесная система  ( белковый бульон)  , то создать печень принципиально не возможно.
 
Живая система  это неравновесная термодинамическая система , для которой естественно находиться в неравновесном состоянии. Свободная энергия Гиббса в этой системе всё время "уводит" систему от состояния равновесия (от смерти). После прихода такой систему к состоянию равновесия (неестественному своему состоянию) её нельзя вновь вернуть в неравновесное состояние. Равновесное состояние для неё неестественно.

  Т.о. необходимым (но не достаточным)  критерием искусственности можно считать способность системы пребывать в равновесном состоянии сколь угодно долго , без ущерба для себя. Например работающую машину (неравновнсное состояние) можно остановить (равновесное состояние) , потом опять запустить. Равновесное состояние доя такой системы естественно. Неравновесное неестественно.

 ***

Но поскольку мы живём в мире-перевёртыше , то вывод напрашивается однозначный.  Жизнь неестественна для нашей вселенной. Она искусственна. Смерть естественна.

 

Так и жизнь сколь угодно долго не будет существовать. Рано или поздно погаснут все звезды и израсходуются все остальные источники энергии и наступит всеобщая смерть. Так что ничего такого неестественного в жизни нет.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 13.01.2020, 12:07:03
Так и жизнь сколь угодно долго не будет существовать. Рано или поздно погаснут все звезды и израсходуются все остальные источники энергии и наступит всеобщая смерть. Так что ничего такого неестественного в жизни нет.

    А почему жизнь исчезнет а смерть останется , а не наоборот? Потому что исчезает неестественное , естественное остаётся 
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 13.01.2020, 12:13:28
    А почему жизнь исчезнет а смерть останется , а не наоборот? Потому что исчезает неестественное , естественное остаётся

Если Вы взялись что-то доказывать, используя научную терминологию, то должны понимать бессмысленность выражения "смерть останется" в рамках Ваших рассуждений.
Смерть это всего лишь момент прекращения жизни. Как она может "остаться" - совершенно непонятно.
Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 13.01.2020, 12:15:02
Это устаревшее или не полное или даже не верное определение.
Нет это как раз верное определение, смысл слова Искусственный  — "сделанный руками человека", никаких других смыслов это слово не несет.

Цитировать
Вместо человека ведь может быть и другое существо, например птица, которая свила гнездо.
Все что не создано руками человека это естественно и кроме человека и Бога разумом никто не обладает.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 13.01.2020, 12:15:17
Потому что исчезает неестественное , естественное остаётся

К естественному термоядерному синтезу в звездах давайте применим. Процесс естественный? Да. Он рано или поздно закончится? Тоже да.
Название: Re: Критерии искусственности объекта.
Отправлено: от 13.01.2020, 12:23:39
Нет это как раз верное определение, смысл слова Искусственный  — "сделанный руками человека", никаких других смыслов это слово не несет.
Все что не создано руками человека это естественно и кроме человека и Бога разумом никто не обладает.
Как же так. Вы же не можете отрицать возможность существования разума во Вселенной и сложно предсказать в какой форме этот разум может существовать. И вообще грани сейчас стираются между искусственным и естественным. Точнее говорить наверное о живой и неживой природе.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 13.01.2020, 12:38:43
Если Вы взялись что-то доказывать, используя научную терминологию

 Никогда не пользуюсь академическим языком на форумах  . Это неуместно. Но с другой стороны , бытовой язык заводит разговор в дебри. Дилемма.

 

Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 13.01.2020, 12:45:39
К естественному термоядерному синтезу в звездах давайте применим. Процесс естественный? Да. Он рано или поздно закончится? Тоже да.

 Неудачный пример. Неравновесная  система  движется к равновесному состоянию ,  теряя энергию с каждой секундой. 
Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 13.01.2020, 12:49:37
Как же так. Вы же не можете отрицать возможность существования разума во Вселенной и сложно предсказать в какой форме этот разум может существовать.
Если существуют инопланетяне, то просто появится новое слово для  определения того что сделано "руками инопланетян".

Цитировать
И вообще грани сейчас стираются между искусственным и естественным.
Грани да, можно стереть, но зачем , вот сходил человек в туалет - это естественно, а нарисовал картину или сделал молоток это искусственно, смысл этих слов использовался веками и думаю не нужно его переделывать.

Цитировать
Точнее говорить наверное о живой и неживой природе.
А тут своя граница, критериев больше и не все так однозначно:

Жизнь — основное понятие биологии — активная форма существования материи, в некотором смысле высшая по сравнению с её физической и химической формами существования[1][2][3]; совокупность физических и химических процессов, протекающих в клетке, позволяющих осуществлять обмен веществ и её деление (вне клетки жизнь не существует, вирусы проявляют свойства живой материи только после переноса генетического материала в клетку). Приспосабливаясь к окружающей среде, живая клетка формирует всё многообразие живых организмов. Основной атрибут живой материи — генетическая информация, используемая для репликации.

Более или менее точно определить понятие «жизнь» можно только перечислением качеств, отличающих её от нежизни. На текущий момент нет единого мнения относительно понятия жизни, однако учёные в целом признают, что биологическое проявление жизни характеризуется: организацией (высокоупорядоченное строение), метаболизмом (получение энергии из окружающей среды и использование её на поддержание и усиление своей упорядоченности), ростом (способность к развитию), адаптацией (адаптированы к своей среде), реакцией на раздражители (активное реагирование на окружающую среду), воспроизводством (все живое размножается), информация, необходимая каждому живому организму, расщепляется в нем, содержится в хромосомах и генах, и передается от каждого индивидуума потомкам[4][5]. Также можно сказать, что жизнь является характеристикой состояния организма.

Также под словом «жизнь» понимают период существования отдельно взятого организма от момента его появления до его смерти[6].

Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 13.01.2020, 13:02:33
К естественному термоядерному синтезу в звездах давайте применим. Процесс естественный? Да. Он рано или поздно закончится? Тоже да.

  Жизнь звезды это не жизнь , а смерть растянутая во времени. Так же как и затухающие колебания маятника.  А вот маятник в часах - вот это настоящая жизнь . Если их постоянно заводить.  ;D
Название: Re: Критерии искусственности объекта.
Отправлено: Александра Максимова от 13.01.2020, 13:07:20
Если существуют инопланетяне, то просто появится новое слово для  определения того что сделано "руками инопланетян".
Грани да, можно стереть, но зачем , вот сходил человек в туалет - это естественно, а нарисовал картину или сделал молоток это искусственно, смысл этих слов использовался веками и думаю не нужно его переделывать.
А тут своя граница, критериев больше и не все так однозначно:

Жизнь — основное понятие биологии — активная форма существования материи, в некотором смысле высшая по сравнению с её физической и химической формами существования[1][2][3]; совокупность физических и химических процессов, протекающих в клетке, позволяющих осуществлять обмен веществ и её деление (вне клетки жизнь не существует, вирусы проявляют свойства живой материи только после переноса генетического материала в клетку). Приспосабливаясь к окружающей среде, живая клетка формирует всё многообразие живых организмов. Основной атрибут живой материи — генетическая информация, используемая для репликации.

Более или менее точно определить понятие «жизнь» можно только перечислением качеств, отличающих её от нежизни. На текущий момент нет единого мнения относительно понятия жизни, однако учёные в целом признают, что биологическое проявление жизни характеризуется: организацией (высокоупорядоченное строение), метаболизмом (получение энергии из окружающей среды и использование её на поддержание и усиление своей упорядоченности), ростом (способность к развитию), адаптацией (адаптированы к своей среде), реакцией на раздражители (активное реагирование на окружающую среду), воспроизводством (все живое размножается), информация, необходимая каждому живому организму, расщепляется в нем, содержится в хромосомах и генах, и передается от каждого индивидуума потомкам[4][5]. Также можно сказать, что жизнь является характеристикой состояния организма.

Также под словом «жизнь» понимают период существования отдельно взятого организма от момента его появления до его смерти[6].
А если компьютер рисует рисунки создавая совершенно новый продукт или синтезируя  музыку-это естественно или искусственно?
Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 13.01.2020, 13:37:34
А если компьютер рисует рисунки создавая совершенно новый продукт или синтезируя  музыку-это естественно или искусственно?

Цель для ПК все равно ставит человек, поэтому это будет искусственно, тем более сами картинки и музыка это и есть искусство. Животные в отличие от человека не способны на искусство и творчество.

Иску́сство (от церк.-слав. искусьство, ст.‑слав. искоусъ — опыт, испытание[1][2]) — образное осмысление действительности; процесс или итог выражения[3] внутреннего или внешнего (по отношению к творцу) мира в художественном образе; творчество, направленное таким образом, что оно отражает интересующее не только самого автора, но и других людей[4].
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 13.01.2020, 14:02:01
Животные в отличие от человека не способны на искусство и творчество.
Ну как сказать, пение птиц чем не творчество?
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 13.01.2020, 14:02:52
  Жизнь звезды это не жизнь , а смерть растянутая во времени. Так же как и затухающие колебания маятника.  А вот маятник в часах - вот это настоящая жизнь . Если их постоянно заводить.  ;D

Хорошо. Давайте другой пример возьмем - ураган. И сравним его с часами. Ураган заводится, по сути, энергией Солнца. Ураган не вечен, как и часы, даже если их постоянно заводить. Вроде бы по основным параметрам ураган и часы ничем не отличаются друг от друга. Кроме одного - ураган возник по естественным причинам, а часы созданы человеком.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 13.01.2020, 14:05:36
Кроме одного - ураган возник по естественным причинам, а часы созданы человеком.
Так, так, по каким критериям определим? Если с нуля, в первый раз увидеть ураган и часы?
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 13.01.2020, 14:05:56
Животные в отличие от человека не способны на искусство и творчество.

Иску́сство (от церк.-слав. искусьство, ст.‑слав. искоусъ — опыт, испытание[1][2]) — образное осмысление действительности; процесс или итог выражения[3] внутреннего или внешнего (по отношению к творцу) мира в художественном образе; творчество, направленное таким образом, что оно отражает интересующее не только самого автора, но и других людей[4].

https://twizz.ru/eta-malenkaya-rybka-stroit-na-dne-takie-shedevry-chto-dazhe-luchshie-arxitektory-mira-ej-pozaviduyut/

История этой рыбы началась с 1995 года, когда на дне Японского моря у архипелага Рюкю водолазы стали находить красивые круговые конструкции диаметром около 2 метров. Что это и зачем — не было ясно долгое время. Почти 20 лет ученые-биологи ломали головы, откуда появляются и как происходят сложные круговые конструкции на песке. Наконец выяснилось, что это брачные сооружения и делают их самцы неизвестного ранее вида иглобрюхов с целью привлечения самок.

Предварительно иглобрюхи расчищают выбранное место от разного мусора, выносят веточки, ракушки, лишние камешки. Во время брачного ритуала самцы вертятся, кружатся и извиваются у самого дна, распахивая его плавниками, создавая таким образом на песчаном дне своеобразное гнездо.

(https://twizz.ru/wp-content/uploads/2017/08/1-85.jpg)
Название: Re: Критерии искусственности объекта.
Отправлено: от 13.01.2020, 14:09:31
Так, так, по каким критериям определим? Если с нуля, в первый раз увидеть ураган и часы?

Не знаю.
Я склоняюсь к мысли, что искомые Вами критерии не существуют потому, что самого разделения, строго говоря, тоже не существует. В рамках материального мира, конечно.

Я раньше сам этим вопросом задавался и пришел к такому вот выводу. Мне хотелось найти что-то, чтобы потом сказать - ну вот видите, вот доказательство существования Творца!
Неа, не выйдет.
Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 13.01.2020, 14:18:57
Ну как сказать, пение птиц чем не творчество?

Пение это естественный процесс для птиц и под определение творчества он не подходит.

Творчество — процесс деятельности, создающий качественно новые материалы и духовные ценности или итог создания объективно нового. Основной критерий, отличающий творчество от изготовления (производства), — уникальность его результата. Результат творчества невозможно прямо вывести из начальных условий. Никто, кроме, возможно, автора, не может получить в точности такой же результат, если создать для него ту же исходную ситуацию. Таким образом в процессе творчества автор вкладывает в материал, кроме труда, некие несводимые к трудовым операциям или логическому выводу возможности, выражает в конечном результате какие-то аспекты своей личности. Именно этот факт придаёт продуктам творчества дополнительную ценность в сравнении с продуктами производства. В творчестве имеет ценность не только результат, но и сам процесс.
Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 13.01.2020, 14:20:09
https://twizz.ru/eta-malenkaya-rybka-stroit-na-dne-takie-shedevry-chto-dazhe-luchshie-arxitektory-mira-ej-pozaviduyut/

История этой рыбы началась с 1995 года, когда на дне Японского моря у архипелага Рюкю водолазы стали находить красивые круговые конструкции диаметром около 2 метров. Что это и зачем — не было ясно долгое время. Почти 20 лет ученые-биологи ломали головы, откуда появляются и как происходят сложные круговые конструкции на песке. Наконец выяснилось, что это брачные сооружения и делают их самцы неизвестного ранее вида иглобрюхов с целью привлечения самок.

Предварительно иглобрюхи расчищают выбранное место от разного мусора, выносят веточки, ракушки, лишние камешки. Во время брачного ритуала самцы вертятся, кружатся и извиваются у самого дна, распахивая его плавниками, создавая таким образом на песчаном дне своеобразное гнездо.

(https://twizz.ru/wp-content/uploads/2017/08/1-85.jpg)

Это естественный процесс для рыбы, тут нет творческой составляющей.

Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 13.01.2020, 14:22:04
В общем критерий таков: всё что создано волей Бога - естественно, все что создано волей человека искусственно.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 13.01.2020, 14:26:46
Хорошо. Давайте другой пример возьмем - ураган. И сравним его с часами. Ураган заводится, по сути, энергией Солнца. Ураган не вечен, как и часы, даже если их постоянно заводить. Вроде бы по основным параметрам ураган и часы ничем не отличаются друг от друга. Кроме одного - ураган возник по естественным причинам, а часы созданы человеком.

 Для кого ураган а для кого и урананчик.  ;D Ураган , Солнце и т.д. - у всех один диагноз - мёртворождённость.  А ведь всё это пришло в мир через нас , человеков. Это прискорбно.  :'(
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 13.01.2020, 14:27:27
Универсального критерия, необходимого признака искусственности не существует. Например, исходя из вашего определения искусственности, кислород на Земле - в значительной степени искусственного происхождения. И практически вся органика ("создана разумом или любым живым существом").

Так что если нет четкости в понятии "искусственности", о каких критериях можно говорить?

Тем не менее, именно сложность системы, информационная система - кандидаты в достаточные признаки искусственности. В том смысле, в каком амёба сложнее галактики.
Четкость как раз выяснили - искусственный сделан разумом.

При рассмотрение сложности и информационных систем должна быть определена критическая масса "сложности" и "кол-ва "информации на ед.объема", которые однозначно скажут об искусственности. Если такой критичной массы нет - объект случайного происхождения, если есть - разумного.

Так слой гальки на берегу моря обладает и низкой сложностью и информацией, и их "масса" не дотягивает до "критичной". Но если из гальки сложить башню, то появится доп.сложность и информационность, которая перевалит за "критичную" и однозначно скажет об искусственности объекта. Следовательно можно вывести общие закономерности (критерии) искусственности. Ведь по этим критериям наш мозг как-то интуитивно это определяет. Но сами критерии сформулировать не можем?


Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 13.01.2020, 14:30:36
Для кого ураган а для кого и урананчик.  ;D Ураган , Солнце и т.д. - у всех один диагноз - мёртворождённость.

Ну да. И по этому критерию всё вышеназванное ничем не отличается ни от часов, ни от человека.

В общем, резюмируем. Жизнь, как одно из явлений во вселенной, ничем не отличается от всего остального, что в ней существует.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 13.01.2020, 14:32:37
Ну да. И по этому критерию всё вышеназванное ничем не отличается ни от часов, ни от человека.

В общем, резюмируем. Жизнь, как одно из явлений во вселенной, ничем не отличается от всего остального, что в ней существует.

   Это точно. Вот тут коротышка в тему. https://youtu.be/qnVuDMT-sXc

  :'(
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 13.01.2020, 14:34:25
   Это точно. Вот тут коротышка в тему. https://youtu.be/qnVuDMT-sXc

  :'(

Ага, типа того))
Видел, да.

Правда, мои знакомые авиаторы долго плевались, когда смотрели на эту посудину  :D
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 13.01.2020, 14:37:59
В общем критерий таков: всё что создано волей Бога - естественно, все что создано волей человека искусственно.
Бог разумен. Человек разумен. Их объединяет общее - разум. Следовательно всё вокруг сделано разумом, искусственно. Это если совсем широко смотреть.

Но если сузить, то выделим две категории объектов: случайные от хаотических физико-хим процессов и искусственные, целенаправленно созданные разумом. 

Какие признаки будут отличать одних от других? Наш мозг это как-то очень быстро определяет/вычисляет.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 13.01.2020, 14:45:50
Это естественный процесс для рыбы, тут нет творческой составляющей.
Естественный, значит случайный. Рыбы случайно это сделали? Или в их мозгу есть вложенные файлы с программой 3-D моделирования песчаного дна по Х,У,Z координатам?

и почему другие рыбы так не делают? Файлов в памяти нет?
Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 13.01.2020, 14:48:46
Бог разумен. Человек разумен. Их объединяет общее - разум. Следовательно всё вокруг сделано разумом, искусственно. Это если совсем широко смотреть.

Но если сузить, то выделим две категории объектов: случайные от хаотических физико-хим процессов и искусственные, целенаправленно созданные разумом. 

Чем одни от других будут отличаться?

Вы отождествляете искусственность с разумом, этого делать не нужно, так как смысл у слов разный, может быть разумно и искусственно - картина, может быть разумно и естественно  - переваривание желудком пищи.

Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 13.01.2020, 15:13:49
Естественный, значит случайный. Рыбы случайно это сделали? Или в их мозгу есть вложенные файлы с программой 3-D моделирования песчаного дна по Х,У,Z координатам?

и почему другие рыбы так не делают? Файлов в памяти нет?

Случайностей нет т.к. всё создано разумно Богом, поэтому естественный - это то что создано волей Бога. Рыба создана волей Бога - она естественна сама и все что она делает соответственно тоже естественно. Все другие рыбы архитекторы так делают, потому что они не обладают волей, чтобы сделать что-то уникальное.

Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 15.01.2020, 10:03:29
Вопрос ко всем:

Если мы наблюдаем объект у которого есть механизмы из шестерёнок - шестерни в зацепление, вращаются и передают крутящий момент на рычаги. Будет ли это достаточным критерием, чтобы считать этот объект созданный разумом?

Название: Re: Критерии искусственности объекта.
Отправлено: Pavel R от 15.01.2020, 11:55:24
Вопрос ко всем:

Если мы наблюдаем объект у которого есть механизмы из шестерёнок - шестерни в зацепление, вращаются и передают крутящий момент на рычаги. Будет ли это достаточным критерием, чтобы считать этот объект созданный разумом?

Критерий что разумно а что нет, устанавливают люди по разному: для теиста все создано Богом, следовательно все разумно, для атеиста созданное человеком разумно, а все остальное создано случайно эволюцией. И похоже этот конфликт неразрешим, т.к. каждый верит во что хочет.

Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 15:02:41
Вопрос ко всем:

Если мы наблюдаем объект у которого есть механизмы из шестерёнок - шестерни в зацепление, вращаются и передают крутящий момент на рычаги. Будет ли это достаточным критерием, чтобы считать этот объект созданный разумом?

 В шестой раз повторю. Если этот шестирёнчатый механизм привести в равновесное состояние ( отключить от источника питания) (лет этак на 10 , для чистоты эксперимента).  Можно эти шестерёнки  потом будет опять запустить?
 Если да -это  вещь искусственно созданная . Если нет -  вещь натуральная.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 15:30:20
 А вот ещё вопрос. Все мы знаем что падающий на землю мяч упадёт на неё. Но если мы видим два объекта , которые не дают мячу упать на землю (как-бы в волебол играют мячом) - можно считать эти объекты искусственно созданными?

 К слову , в энергетике живой клетки  энтальпийная и энтропийная составляющие энергии Гиббса действуют подобно двум этим волейболистам.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 15.01.2020, 15:51:33
В шестой раз повторю. Если этот шестирёнчатый механизм привести в равновесное состояние ( отключить от источника питания) (лет этак на 10 , для чистоты эксперимента).  Можно эти шестерёнки  потом будет опять запустить?
 Если да -это  вещь искусственно созданная . Если нет -  вещь натуральная.

Да хоть в шестьдесят шестой. Критерий неверный.

Вот еще пример - круговорот воды в природе. Испарение/осадки. Отключите систему от источника энергии, наступит зима и когда вся влага из воздуха сконденсируется, выпав в виде дождя или снега, процесс закончится. А при наступлении тепла возобновится. По Вашему критерию круговорот воды в природе процесс искусственный, ибо перезапустить его можно.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 15.01.2020, 15:58:20
В шестой раз повторю. Если этот шестирёнчатый механизм привести в равновесное состояние ( отключить от источника питания) (лет этак на 10 , для чистоты эксперимента).  Можно эти шестерёнки  потом будет опять запустить?
 Если да -это  вещь искусственно созданная . Если нет -  вещь натуральная.
Да, можно запустить. Этот механизм уже находится в равновесном состояние. В какой-то момент времени работает, а в какой-то стоит на месте, потом шестерни опять крутятся.

(https://upload.wikimedia.org/wikipedia/commons/1/14/Gears_animation.gif)

(https://upload.wikimedia.org/wikipedia/commons/c/c2/Involute_wheel.gif)

Обратите внимание на математическую точность, необходимую для работы шестерен.. Для этого надо точно рассчитать модуль зуба, шаг зуба, нормаль, высоту зуба, диаметры колёс, межцентровое расстояние и материал зуба, чтоб не сломались. 7 точных параметров.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 15.01.2020, 16:12:45
Да хоть в шестьдесят шестой. Критерий неверный.

Вот еще пример - круговорот воды в природе. Испарение/осадки. Отключите систему от источника энергии, наступит зима и когда вся влага из воздуха сконденсируется, выпав в виде дождя или снега, процесс закончится. А при наступлении тепла возобновится. По Вашему критерию круговорот воды в природе процесс искусственный, ибо перезапустить его можно.
Это то, чем круговорот воды и ураган отличается от часов с шестернями. В первом случаи на макро-уровне имеем простой односложный механизм из 1 простого элемента - воздух или вода. Во втором случаи, на макро-уровне имеем многосложный из N элементов, где каждый элемент ещё имеет свою индивидуальную многосложность, от которой зависит работа всего механизма.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 15.01.2020, 16:20:48
Это то, чем круговорот воды и ураган отличается от часов с шестернями. В первом случаи на макро-уровне имеем простой односложный механизм из 1 простого элемента - воздух или вода. Во втором случаи, на макро-уровне имеем многосложный из N элементов, где каждый элемент ещё имеет свою индивидуальную многосложность, от которой зависит работа всего механизма.

Вот Вам пример посложнее - Шестиугольник Сатурна (https://ru.wikipedia.org/wiki/%D0%A8%D0%B5%D1%81%D1%82%D0%B8%D1%83%D0%B3%D0%BE%D0%BB%D1%8C%D0%BD%D0%B8%D0%BA_%D0%A1%D0%B0%D1%82%D1%83%D1%80%D0%BD%D0%B0)
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 15.01.2020, 16:36:48
Вот Вам пример посложнее - Шестиугольник Сатурна (https://ru.wikipedia.org/wiki/%D0%A8%D0%B5%D1%81%D1%82%D0%B8%D1%83%D0%B3%D0%BE%D0%BB%D1%8C%D0%BD%D0%B8%D0%BA_%D0%A1%D0%B0%D1%82%D1%83%D1%80%D0%BD%D0%B0)
Уже близко к искусственности, но до критичной массы не дотягивает - всего один сложный элемент. Надо чтобы таких сложных элементов было несколько и они работали как один механизм.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений Михайлов от 15.01.2020, 16:40:13
Уже близко к искусственности...

Мы еще не вывели критериев искусственности, а Вы объявили, что уже близко.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 18:21:38
Критерий неверный.

   Ну я не знаю. Моё имхо такое что молекула воды если испарилась , то надо её вечно гонять по небу , тогда это будет неравновесное состояние. А как только она упадёт обратно в воду и сцепится водородными связями с остальными молекулами воды - это уже равновесное состояние. Когда она потом опять испариться - через микросекунду или через 10 лет - это уже не принципиально. Она не должна находиться в равновесном состоянии нисколько вообще.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 18:25:51
Да, можно запустить. Этот механизм уже находится в равновесном состояние. В какой-то момент времени работает, а в какой-то стоит на месте, потом шестерни опять крутятся.

 Всё верно. Время состоит из кайросов и хроносов.  Время кайроса это когда шестерёнки стоят , время хроноса - когда движутся. 
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 15.01.2020, 18:50:45
Мы еще не вывели критериев искусственности, а Вы объявили, что уже близко.
Один из критериев даёт нам часовой механизм- многосложные элементы связаны меж собой в работающий механизм.

Ещё будет ли таким критерием являться почтовая система: посылки маркируется адресами и доставляются точно по адресам?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 15.01.2020, 19:02:02
Всё верно. Время состоит из кайросов и хроносов.  Время кайроса это когда шестерёнки стоят , время хроноса - когда движутся.
И? Этот механизм из шестерёнок выполнил ваше условие на искусственность, теперь вы признаете его искусственным?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 15.01.2020, 19:13:22
А вот ещё вопрос. Все мы знаем что падающий на землю мяч упадёт на неё. Но если мы видим два объекта , которые не дают мячу упать на землю (как-бы в волебол играют мячом) - можно считать эти объекты искусственно созданными?

 К слову , в энергетике живой клетки  энтальпийная и энтропийная составляющие энергии Гиббса действуют подобно двум этим волейболистам.
Если аналогия с мячом, то мяч может попасть в паутину гибких каучуковых смол (от каучук.дерева) и прыгать на них сколько вздумается.  :)

Если эти объекты точно следуют за мячом и не дают упасть, то на лицо несколько интеллект-факторов: сканирование мяча, анализ его траекторий, расчёт встречных движений. Естественно это интеллектуальные действия, следовательно созданы разумом, искусственны. Любая собака или дельфин, умеющие отбивать мяч, попадают под этот критерий.   
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 19:44:49
И? Этот механизм из шестерёнок выполнил ваше условие на искусственность, теперь вы признаете его искусственным?

 Если бы. Всё намного хуже. Оказывается само Время искусственно. Оно в какой-то момент останавливает механизм для того , чтобы в следующий момент он начал работать снова , "с чистого листа" так сказать.  Таким образом механизму даётся шанс изменить что-нибудь в своей работе. Увеличить скорость шестерёнок например или уменьшить.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 19:47:29
  Любая собака или дельфин, умеющие отбивать мяч, попадают под этот критерий.   

 Эти правила (современного волейбола) позаимствованы из древнеиндЕйской игры в мяч. Главное правило -отбить мяч , ни на секунду не задерживая его в руке. Иначе это будет пионербол.  ;D
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 15.01.2020, 19:50:30
http://orthodoxy.cafe/index.php?topic=645732.0
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 20:06:53
Ещё насчёт системы вода-пар-вода. 

 В состоянии  равновесия (по определению) термодинамическая система обладает минимумом своей свободной энергии при данных условиях (при данной температуре , давлении , объме). Таким образом , при данных определённых условиях система вода-пар будет находится в состоянии равновесия. Чуть изменятся условия (p , V , T) система перейдёт в новое равновесное состряние. Сам момент перехода будет неравновесным состоянием. То есть мы имеем череду равновесных и неравновесных состояний , что не попадает под определение строго неравновесного состояния. Неравновесное это когда шестерёнки двигают велосипед  таким образм , что при их мгновенной остановке мгновенно останавливается и сам велосипед. 

 

Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 20:11:27
http://orthodoxy.cafe/index.php?topic=645732.0

  Что это за КИД? Что за аббревиатура? Что она означает.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 20:12:23
 Критерий Искусственности Действия?
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 15.01.2020, 20:16:37
  Что это за КИД? Что за аббревиатура? Что она означает.

Критерий интеллектульного дизайна. Но это чисто мнемоника.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 21:09:30
Критерий интеллектульного дизайна. Но это чисто мнемоника.

 Мне ближе термодинамика.

   :)
 
  Вот два постулата. Из первого следует что существует дьявол. Из второго что существует Бог. (И в конце мультик .)

 1. Любая материальная система в этом мире стремится к минимуму своей свободной энергии (G мин.) , т.е. к состоянию равновесия. В том числе и тело человека. Это можно назвать стремлением к смерти , естественным процессом. (Князь мира сего есть диавол)

 2) Но есть некоторая сила , которая заставляет некоторые  материальные системы постоянно пополнять  запас свободной энергии таким образом ,  чтобы он никогда не достигал своего минимума при данных условиях ( напр. при Т = 36,6⁰С и т.д. для человека) . Эта сила противодействует естественному процессу . Такую силу можно назвать разумной .

 
 

 https://youtu.be/FYbhOcx1RcM

 
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 22:02:22
 Сам вопрос темы это диалектика. Искусственное/неискусственное. В будущем веке не будет диалектических пар.  Не будет прошлого/будущего (только настоящее) , мужского/женского , верха/низа (лево/право) и т.д. вплоть до того что не будет разделения на Творца и творение , когда человек станет богом по благодати. 
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 15.01.2020, 22:19:16
Мне ближе термодинамика.

   :)
 
  Вот два постулата. Из первого следует что существует дьявол. Из второго что существует Бог. (И в конце мультик .)

 1. Любая материальная система в этом мире стремится к минимуму своей свободной энергии (G мин.) , т.е. к состоянию равновесия. В том числе и тело человека. Это можно назвать стремлением к смерти , естественным процессом. (Князь мира сего есть диавол)

 2) Но есть некоторая сила , которая заставляет некоторые  материальные системы постоянно пополнять  запас свободной энергии таким образом ,  чтобы он никогда не достигал своего минимума при данных условиях ( напр. при Т = 36,6⁰С и т.д. для человека) . Эта сила противодействует естественному процессу . Такую силу можно назвать разумной .

 
 

 https://youtu.be/FYbhOcx1RcM

Непереводимая игра слов.  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 23:24:28
Непереводимая игра слов.  :)
Да , тут лучше сразу сдаваться без боя. Илья Пригожин принял вызов и проиграл. Кто-нибудь из атеистов хочет встать на защиту Пригожина ?
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 15.01.2020, 23:29:00
 В смысле не кто-нибудь , а тот , кто хорошо разбирается в химии и в термодинамике. 
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 16.01.2020, 09:52:37
В смысле не кто-нибудь , а тот , кто хорошо разбирается в химии и в термодинамике.

Не моя отрасль.  Но чисто интересно, какая сила препятствует достижению абсолютного температурного нуля? Это дьявольские происки или божий промысел?  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 16.01.2020, 18:34:48
Если бы. Всё намного хуже. Оказывается само Время искусственно. Оно в какой-то момент останавливает механизм для того , чтобы в следующий момент он начал работать снова , "с чистого листа" так сказать.  Таким образом механизму даётся шанс изменить что-нибудь в своей работе. Увеличить скорость шестерёнок например или уменьшить.
Время здесь не причём. Вы лично при желание можете их покрутить.

Кстати, кто утверждает, что в Библии есть ошибка, что небо это твердь, ошибается. Небо, т.е. пространство, это действительно твердь. Пространство искривляется как обычное твердое тело:

(https://steemitimages.com/DQmfXJcMHbjiswUPJgzjVgibWqSkKRAvMcGksfMp68x9Xyb/BitCoinGravity.png)


Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 16.01.2020, 20:36:40
Но чисто интересно, какая сила препятствует достижению абсолютного температурного нуля?

  Абсолютный ноль это как "смерть" температуры. Когда есть температура - нет ноля , когда есть ноль - нет температуры.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 16.01.2020, 20:39:23
Пространство искривляется как обычное твердое тело.

   Не пространство искривляется , а пространство-время искривляется.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 16.01.2020, 20:43:15
  Абсолютный ноль это как "смерть" температуры. Когда есть температура - нет ноля , когда есть ноль - нет температуры.

Ну и что, помрет да и оживет, эка невидаль. Миллиарды людей вон собирались/собираются ожить после смерти.  :D Так кто не дает достичь "смерти" температуры?
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 16.01.2020, 21:03:59
Миллиарды людей вон собирались/собираются ожить после смерти.  :D

  Это тоже самое что сказать - температура Кельвина собирается опять поползти вверх после достижения абсолютного нуля.  :D Теперь сами сможете ответить на свой вопрос.  ;)
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 16.01.2020, 21:22:12
   Смерть! где твое жало? ад! где твоя победа?   1-е Коринфянам 15:55

  Где ты , абсолютный ноль Кельвина?  :D :D :D

 

 
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий Федорович от 16.01.2020, 22:26:29
Вопрос ко всем:

Если мы наблюдаем объект у которого есть механизмы из шестерёнок - шестерни в зацепление, вращаются и передают крутящий момент на рычаги. Будет ли это достаточным критерием, чтобы считать этот объект созданный разумом?
У прыгающего насекомого из семейства "иссид", конечности работают на зубчатой передаче.
https://ok.ru/video/1485732317748 (https://ok.ru/video/1485732317748)
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 16.01.2020, 23:35:00
  Смерть! где твое жало? ад! где твоя победа?   1-е Коринфянам 15:55

  Где ты , абсолютный ноль Кельвина?  :D :D :D

Я слышал, в ВЗ совсем не про физику. Или про термодинамику как раз ?   :)

Дык это,  кто же не дает до того нуля добраться? Удастся нам послушать начальника транспортного цеха?
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 17.01.2020, 14:15:28
Удастся нам послушать начальника транспортного цеха?

А у меня уже текст закончился.  ;D

 
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 17.01.2020, 16:07:51
   Не пространство искривляется , а пространство-время искривляется.
Искривление тверди пространство-времени.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 17.01.2020, 16:10:25
А у меня уже текст закончился.  ;D

Ну нет так нет.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 17.01.2020, 16:12:33
У прыгающего насекомого из семейства "иссид", конечности работают на зубчатой передаче.
https://ok.ru/video/1485732317748 (https://ok.ru/video/1485732317748)
И? Будет передача на шестернях со своим точным математическим моделированием являться достаточным критерием искусственности?
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 17.01.2020, 17:34:12
Ну нет так нет.

 Нет там не так у Карцева. Начальник транспортного цеха говорит - у меня уже текст закончился. А директор говорит - ну тогда переходим к торжественной части , прошу всех к столу. Примерно так.
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий Федорович от 18.01.2020, 05:01:38
И? Будет передача на шестернях со своим точным математическим моделированием являться достаточным критерием искусственности?

    Не могу знать. Ваш вопрос звучал абстрактно, я  же привел реальный пример наличия в живой природе биологического организма,  в котором есть механизм - зубчатой  передачи. Это насекомое ( Issus coleoptratusу). 
(  Размер механизма около 400 микрометров. Синхронизация движения ног позволяет нимфе прыгать с впечатляющей скоростью 4 м/с в точно заданном направлении. Как отмечают исследователи, обычные нервные импульсы не позволили бы достигнуть такого же уровня синхронизации движений при толчке от поверхности (разница между движениями ног у нимфы при прыжке составила всего 30 микросекунд). Эти шестерни являются первым действующим зубчатым зацеплением).                                                                                                                           
     Обнаружено это было, если не ошибаюсь в 2013 г."
     Для верующего - это просто  еще одно доказательство целесообразности, для сомневающегося- не знаю, для махрового атеиста, у которого материя может эволюционировать во, что угодно -наверно нет. Вспоминаю - мертвую эволюцию в романе С. Лема -"Непобедимый".
  Доказательством в рамках научного подхода? Как уже указывалось выше, надо четко определить рамки: искусственное, естественное.         
   Человек пытается заглянуть в "чрево земли", подняться в космос, а настоящие чудеса -рядом, протяни руку.

  Кстати, есть насекомое, у которого конечности соединены по принципу -болт с резьбой и гайка. Конечно -это не так впечатляет, как зубчатая передача, но тоже интересно. 

Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 18.01.2020, 10:54:50
Как уже указывалось выше, надо четко определить рамки: искусственное, естественное.

Очевидно, каким бы ни был этот критерий, он должен хотя бы иногда указывать на естественное, а иногда на искусственное. А порой может ни на что не указывать, типа недостаточно информации.
Если же некий критерий всегда показывает одно и то же, то он не критерий по определению.

Выходит одно из двух, или естественное существует или критерий невозможен.
Верующие очевидно должны придерживаться второй точки зрения, ибо допустить существование чего-то абсолютно естественного, ни каким Богом не сотворенного, это с верой в Бога никак не совместимо.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 18.01.2020, 11:52:29
Очевидно, каким бы ни был этот критерий, он должен хотя бы иногда указывать на естественное, а иногда на искусственное. А порой может ни на что не указывать, типа недостаточно информации.
Если же некий критерий всегда показывает одно и то же, то он не критерий по определению.

Выходит одно из двух, или естественное существует или критерий невозможен.
Верующие очевидно должны придерживаться второй точки зрения, ибо допустить существование чего-то абсолютно естественного, ни каким Богом не сотворенного, это с верой в Бога никак не совместимо.

 
   Естественное - не сотворённое разумно человеком.

 Искуственное - сотворённое разумно человеком

 Естественное - сотворённое разумно сверхъестественным.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 18.01.2020, 13:30:46
Естественное - сотворённое разумно сверхъестественным.

"Естественное суть сотворённое"  ;D  Как и было предсказано.  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 18.01.2020, 14:13:44
"Естественное суть сотворённое"  ;D  Как и было предсказано.  :)

  Прочитайте ещё раз , только   внимательно.
  Естественное - не сотворённое разумно человеком. .
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 19.01.2020, 19:53:22
  Прочитайте ещё раз , только   внимательно.
  Естественное - не сотворённое разумно человеком. .

.. И пиво тоже. :)
Я читаю именно что внимательно, все что написано.  И написано - "Естественное суть сотворённое". 
Уберите лишнее, оставьте только коньяк или водочку. Может какой смысл и появитси.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 19.01.2020, 21:32:02
Может какой смысл и появитси.

 А чего ж нет.  Потом поговорим , сегодня праздник Крещения . Как проведёшь этот праздник , так и весь год проведёшь. В смысле , завтра поговорим.
     
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 20.01.2020, 10:37:32
.. И пиво тоже. :)
"Естественное суть сотворённое". 

 Тут у вас софистическая ошибка ударения (на слово "сотворённое"). Такие ошибки обычно допускают чиновники в своих устных отказах. Последний раз я с этим столкнулся когда мне директор сказал что  "переход права есть уничтожение и возникновение" и сделал ударение на слове "возникновение" . То есть переход права это есть возникновение права , сказал он. И т.о. подменил понятия возникновение и уничтожение.  Но в письменных ответах чиновники не допускают таких ошибок потому что это уже документ , который можно приложить в суде к исковому заявлению.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 20.01.2020, 11:13:37
И т.о. подменил понятия возникновение и уничтожение. 

Тут описка. Правильно сказать - подменил понятия "возникновение" и "переход".

 Естественное - не сотворённое человеком. Но сотворённое Богом.  Если делать ударение на том , что естественное это обязательно не сотворённое , то мы впадём в софистику , как это делал Сократ.  И это долгое время оставалось незамеченным греками (последним "греком" был Хайдеггер). А вот уже Деррида заметил что Сократ-то оказывается софистом был.  ;D
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 20.01.2020, 11:36:11
Тут у вас софистическая ошибка ударения (на слово "сотворённое"). Такие ошибки обычно допускают чиновники в своих устных отказах. Последний раз я с этим столкнулся когда мне директор сказал что  "переход права есть уничтожение и возникновение" и сделал ударение на слове "возникновение" . То есть переход права это есть возникновение права , сказал он. И т.о. подменил понятия возникновение и уничтожение.  Но в письменных ответах чиновники не допускают таких ошибок потому что это уже документ , который можно приложить в суде к исковому заявлению.

Не ходите кругами вокруг да около. Можно из вашего "определения" выбросить этот "софизм " , "Естественное - это сотворенное" или нельзя? Можно так выбросьте, нельзя так отвечайте за свои слова.
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 20.01.2020, 14:59:15
"Естественное - это сотворенное"

  Это обратно обрезанный (софистический) вариант с ударением на "сотворённое". Правильно говорить "естественное это сотворённое Богом".
   
 https://youtu.be/1nj5H9KlWzM
 
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 20.01.2020, 15:25:10
  Это обратно обрезанный (софистический) вариант с ударением на "сотворённое". Правильно говорить "естественное это сотворённое Богом".
   
 https://youtu.be/1nj5H9KlWzM
 

Есть что сказать, говорите текстом, пригодным для цитирования. Кино я посмотрю сам какое захочу.
Так  можно из вашего "определения" выбросить этот "софизм", "Естественное - это сотворенное" или нельзя?
Название: Re: Критерии искусственности объекта.
Отправлено: Эдуард Вл. от 20.01.2020, 15:37:39
Есть что сказать, говорите текстом, пригодным для цитирования.

     Кто в теме тот растащит на цитаты то что я уже написал. Я виноват чтоли что атеисты не в теме. 
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 20.01.2020, 18:31:20
     Кто в теме тот растащит на цитаты то что я уже написал. Я виноват чтоли что атеисты не в теме.
Кто-то что-то куда-то непременно растащит.
Но ответа как не было так и нет. Ну не больше не настаиваю.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 16.04.2020, 19:53:40
Универсального критерия, необходимого признака искусственности не существует. Например, исходя из вашего определения искусственности, кислород на Земле - в значительной степени искусственного происхождения. И практически вся органика ("создана разумом или любым живым существом").

Так что если нет четкости в понятии "искусственности", о каких критериях можно говорить?

Тем не менее, именно сложность системы, информационная система - кандидаты в достаточные признаки искусственности. В том смысле, в каком амёба сложнее галактики.

Критерием искусственности или разумности должна быть мысль и её выражение с слове. Это совершенно естественно если мы читаем книгу, то критерием искусственного будет информация и смысл. Для автоматических систем критерием искусственность будет технологическая карта автоматизированного процесса и программа действий. Атомы, из которых состоят молекулы это физические динамические объекты хаотично движущие в пространстве, но эти элементарные смысловые знаки языка химии имеют определенною геометрическую пространственную форму электронных облаков, что накладывает ограничения на количество возможных молекулярных соединений, что повышает вероятность сложных молекулярных соединений случайным образом. Такие молекулы как нуклеотиды и аминокислоты могут считаться созданные случайным образом. Критерий искусственности начинает проявляться в триплетах кордонах кодирующих аминокислоты. Полинуклеотидная цепочка триплета это уже мысль выраженное в слове смысл которого аминокислота. Ген это смысловое предложение. Но это предложение пишется динамическим способом присоединения к одному из двух концов смыслового кодона. Это уже не случайный процесс а письмо текста. Ген пишется неслучайным способом, а с применением химического языка программирования. Только один кодон кодирует начало предложения, три стоп-кодона конец предложения. Но полинуклеотидная цепочка собирается также как собираются бусы, каждая бусинка это один из 8 возможных нуклеотидов, учитывая хиральность сахаров. Правильный текст пишется из 4 нуклеотидов хирально чистыми левыми сахарами. Сам генетический текст не терпит ни каких случайных ошибок, написанная программа написана грамотно. Хотя природа грамоте не обучена.               
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей Як от 30.06.2020, 21:04:18
Критерий естественности в современном понимании подразумевает несотворённость. Такой критерий появляется только при отказе от религии.
В рамках религии речь может идти о божественном и человеческом.
Название: Re: Критерии искусственности объекта.
Отправлено: Nikolai M. от 01.07.2020, 02:45:17
Мне ближе термодинамика.

   :)
 
  Вот два постулата. Из первого следует что существует дьявол. Из второго что существует Бог. (И в конце мультик .)

 1. Любая материальная система в этом мире стремится к минимуму своей свободной энергии (G мин.) , т.е. к состоянию равновесия. В том числе и тело человека. Это можно назвать стремлением к смерти , естественным процессом. (Князь мира сего есть диавол)

 2) Но есть некоторая сила , которая заставляет некоторые  материальные системы постоянно пополнять  запас свободной энергии таким образом ,  чтобы он никогда не достигал своего минимума при данных условиях ( напр. при Т = 36,6⁰С и т.д. для человека) . Эта сила противодействует естественному процессу . Такую силу можно назвать разумной .
 https://youtu.be/FYbhOcx1RcM
vse tak.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 01.07.2020, 07:44:49
    Не могу знать. Ваш вопрос звучал абстрактно, я  же привел реальный пример наличия в живой природе биологического организма,  в котором есть механизм - зубчатой  передачи. Это насекомое ( Issus coleoptratusу). 
(  Размер механизма около 400 микрометров. Синхронизация движения ног позволяет нимфе прыгать с впечатляющей скоростью 4 м/с в точно заданном направлении. Как отмечают исследователи, обычные нервные импульсы не позволили бы достигнуть такого же уровня синхронизации движений при толчке от поверхности (разница между движениями ног у нимфы при прыжке составила всего 30 микросекунд). Эти шестерни являются первым действующим зубчатым зацеплением).                                                                                                                           
     Обнаружено это было, если не ошибаюсь в 2013 г."
     Для верующего - это просто  еще одно доказательство целесообразности, для сомневающегося- не знаю, для махрового атеиста, у которого материя может эволюционировать во, что угодно -наверно нет. Вспоминаю - мертвую эволюцию в романе С. Лема -"Непобедимый".
  Доказательством в рамках научного подхода? Как уже указывалось выше, надо четко определить рамки: искусственное, естественное.         
   Человек пытается заглянуть в "чрево земли", подняться в космос, а настоящие чудеса -рядом, протяни руку.

  Кстати, есть насекомое, у которого конечности соединены по принципу -болт с резьбой и гайка. Конечно -это не так впечатляет, как зубчатая передача, но тоже интересно.
Насекомые - биороботы. ничего удивительного, если они сконструированы.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 22.07.2020, 08:06:56
Существуют ли научные разработки таких критериев? Кто-то в учёном сообществе этим занимался?

Прошу не брать в рассмотрение "не уменьшаемую сложность систем", так как это частный случай для некоторых узких био-систем и не работает как универсальный критерий для других объектов.
если вероятность возникновения случайным образом полинуклеотидной цепочки ДНК в хирально чистом, равномерно распределенных в равных частях нуклеотидов  в растворе  равна 10-1800000000, то это критерий искусственности.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 01.08.2020, 21:12:01
Универсального критерия, необходимого признака искусственности не существует. Например, исходя из вашего определения искусственности, кислород на Земле - в значительной степени искусственного происхождения. И практически вся органика ("создана разумом или любым живым существом").

Так что если нет четкости в понятии "искусственности", о каких критериях можно говорить?

Тем не менее, именно сложность системы, информационная система - кандидаты в достаточные признаки искусственности. В том смысле, в каком амёба сложнее галактики.
Константин куда вы пропали? Литературный текст высеченный в камне, критерий искусственности это смысл и язык выражения смыслового содержания. Если мы понимаем смысл написанного и язык, то мы как само разумеющееся понимаем что это плод разума. Камень это продукт природы, а вот текст продукт творческого разума. ДНК как и камень это продукт природы макромолекула. Но кроме природных свойств в ней есть текст, который мы можем осмысленно читать и язык, который мы понимаем. В нем есть своя орфография и пунктуация как и в любом языке, есть буквы, алфавит, слова предложения и знаки препинания, механизм транскрипции и трансляции смысла. Слово-триплет имеет либо смысл старт-кодона, либо стоп-кодона,начала и конца предложения, а последовательность кодонов это ген-предложение, которое имеет кодирования белка, из предложений складывается обшей текст генотипа, который выражается в смысле фенотипа, в разнообразит живой материи. Раз мы считаем что текст на берестяных грамотах или камнях имеет искусственное разумное происхождение, то и текст в ДНК тоже должен иметь искусственное происхождение.           
Название: Re: Критерии искусственности объекта.
Отправлено: Георгий Саликов от 02.08.2020, 19:30:36

   Естественное - не сотворённое разумно человеком.

 Искуственное - сотворённое разумно человеком

 Естественное - сотворённое разумно сверхъестественным.
Стало быть, человек - существо "сверхъискусственое".
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 02.08.2020, 20:23:26
Цитировать
Естественное - не сотворённое разумно человеком.

 Искуственное - сотворённое разумно человеком

 Естественное - сотворённое разумно сверхъестественным.
Стало быть, человек - существо "сверхъискусственое".
Естественные процессы модно описать уравнениями движения, материальная точка движется по такой траектории когда разность кинетической и потенциальной энергии под интегралом дает наименьшее действие. Полная энергия замкнутой системы сумма кинетической и потенциальной энергии постоянная величена. А так как внутри системы плотность энергии неоднородна, то все материальные точки движутся по траекториям определенными этими неоднородностями. Естественные процессы могут насылать курган высотой с пирамиду Хеопса, но чтобы возникла пирамида Хеопса, нужно чтобы интеллект(Разум) взял в управление параметрами уравнения движения материальными точками. Управлять разум будет естественными процессами, ну как вы управляете автомобилем, станком, краном, каменотесной машиной. Искусственный процесс подгоняет естественный процесс в разумные рамки целесообразности и целеполагания. Естественный процесс происходит в рамках принципа наименьшего действия, на который указал выше, искусственный процесс в принцип наименьшего действия вносит разумный элемент управления движением в рамках этого принципа, чтобы кирпич положить в кладку нужно его туда перенести управляя его траекторией с помощью рук или крана. Это естественный интеллектуальный динамический процесс, управляемый ходом мыслей и действием рук. Сверхъестественный процесс это управление движением путем привнесение в замкнутую систему где полная энергия постоянная новой энергии-материи, управляемый процесс творения из ничего. Со стороны это выглядело бы как управляемое Сверхразумом движение материальной точки возникшей ниоткуда или просто движение материальной точки по управляемой траектории. Как по волшебству в мире Гарри Поттера, где сила претворяющая воду вино божественная.           
Название: Re: Критерии искусственности объекта.
Отправлено: Корякин от 08.08.2020, 00:31:49
если вероятность возникновения случайным образом полинуклеотидной цепочки ДНК в хирально чистом, равномерно распределенных в равных частях нуклеотидов  в растворе  равна 10-1800000000, то это критерий искусственности.
Александр, Вы повторяете свою мысль снова и снова. Насколько бы ни была мала вероятность возникновения ДНК случайным образом это не делает искусственное происхождение ДНК более вероятным.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 08.08.2020, 04:07:16
Александр, Вы повторяете свою мысль снова и снова. Насколько бы ни была мала вероятность возникновения ДНК случайным образом это не делает искусственное происхождение ДНК более вероятным.
представьте такую ситуацию у вас водонепроницаемый ноутбук, вы собрались в ворде написать письмо. Неожиданно пошел грибной ливень на час, вы ушли быстро в дом, а компьютер не выключили. Через час вы сели вновь за компьютер, а ворде у вас глава из Евгения Онегина. На сколько мала вероятность что это дождь накапал по клавиатуре, будем считать что веса капли достаточно чтобы сила давления на клавишу достаточно чтобы прошёл сигнал и отпечатался знак. Конечно вероятность ненулевая что это дождик накрапал, какова вероятность того что это сделал другой человек? Не обезьяна, а грамотный и образованный человек? ДНК это тажа высокоинтеллектуальная литература со смыслом и языком изложения. У природы нет такого молекулярного механизма печати, кроме как выталкивать молекулами воды малые гидрофобные молекулы друг другу, а гидрофильные молекулы увлекать встроенных водородными связями в пространственную решетку сотканную из молекул воды. Даже при температуре 37 градусов по цельсии структура воды образует мерцающие кластеры где каждая молекула воды водородными связями соединяются с четырьмя другими молекулами воды. С повышением температуры водного раствора молекулярная решетка воды становится подвижной и нестабильной, все растворенные в воде молекулы и те что не растворяются воде начинают движение в хаотическом потоке молекул воды это очень хорошо заметно когда вода закипает. В круговороте молекул воды растворенные в ней молекулы и те что не взаимодействуют водородными связями с молекулами воды начинают сближаться и взаимодействовать друг с другом совершенно случайным образом формируя макромолекулы. ДНК макромолекула с высокоинтеллектуальным смыслом последовательность малых молекул смысловых едениц, проблема в том что без ИД смысловая последовательность при имеющимся природном механизме случайных взаимодействий малых молекул с макромолекулой ДНК не может быть создана в приемлемой вероятностью случайным образом, точно также как ливень не может напечатать главу из Евгения Онегина. ДНК это непросто полинуклеотидная цепь собранная из нуклеотидов, это текст, и текст такого высочайшего интеллектуального уровня, который пытаются прочесть миллионы генетиков по всему миру.                   
Название: Re: Критерии искусственности объекта.
Отправлено: Лаврентьевич от 08.08.2020, 06:29:49
представьте такую ситуацию у вас водонепроницаемый ноутбук, вы собрались в ворде написать письмо. Неожиданно пошел грибной ливень на час, вы ушли быстро в дом, а компьютер не выключили. Через час вы сели вновь за компьютер, а ворде у вас глава из Евгения Онегина. На сколько мала вероятность что это дождь накапал по клавиатуре, будем считать что веса капли достаточно чтобы сила давления на клавишу достаточно чтобы прошёл сигнал и отпечатался знак. Конечно вероятность ненулевая что это дождик накрапал, какова вероятность того что это сделал другой человек? Не обезьяна, а грамотный и образованный человек? ДНК это тажа высокоинтеллектуальная литература со смыслом и языком изложения. У природы нет такого молекулярного механизма печати, кроме как выталкивать молекулами воды малые гидрофобные молекулы друг другу, а гидрофильные молекулы увлекать встроенных водородными связями в пространственную решетку сотканную из молекул воды. Даже при температуре 37 градусов по цельсии структура воды образует мерцающие кластеры где каждая молекула воды водородными связями соединяются с четырьмя другими молекулами воды. С повышением температуры водного раствора молекулярная решетка воды становится подвижной и нестабильной, все растворенные в воде молекулы и те что не растворяются воде начинают движение в хаотическом потоке молекул воды это очень хорошо заметно когда вода закипает. В круговороте молекул воды растворенные в ней молекулы и те что не взаимодействуют водородными связями с молекулами воды начинают сближаться и взаимодействовать друг с другом совершенно случайным образом формируя макромолекулы. ДНК макромолекула с высокоинтеллектуальным смыслом последовательность малых молекул смысловых едениц, проблема в том что без ИД смысловая последовательность при имеющимся природном механизме случайных взаимодействий малых молекул с макромолекулой ДНК не может быть создана в приемлемой вероятностью случайным образом, точно также как ливень не может напечатать главу из Евгения Онегина. ДНК это непросто полинуклеотидная цепь собранная из нуклеотидов, это текст, и текст такого высочайшего интеллектуального уровня, который пытаются прочесть миллионы генетиков по всему миру.                   
Впечатляет.  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 08.08.2020, 15:04:42
Впечатляет.  :)
Быт.1:2 Земля же была безвидна и пуста, и тьма над бездною, и Дух Божий носился над водою.
Дух Божий можно понимать как сверхъестественное сила. Святая вода по своей структуре это сцепленные водородными связями молекулы воды в единую сеть, которая может распадаться на мерцающие кластеры и объединятся вновь, но траектория движение молекул может быть управляема Духом Божим. То есть святая вода может быть тем сверхъестественным механизмом сборки, с помощью которого все растворенные в ней гидрофильные и гидрофобные молекулы действием силы Духа Божия обретали строго заданные траектории движения в растворе, там где необходимо замыслу выталкивали ненужные молекулы во вне, а те что нужны для правильной сборке подтягивали в зону взаимодействия химических связей. В обычных условиях молекулы воды ведут себя так:
(https://sun9-20.userapi.com/nt_S6E9vxnx6cdL3hCuAk9PvTE2037h_qtyEaA/5kn9Z28CZC0.jpg)

(https://sun9-21.userapi.com/14eggUtvoNGcZSV2zKFxRg-xTHM8ztSb_FDf6w/b5ldBMjP8ow.jpg)           
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 01.09.2020, 00:34:33
Александр, Вы повторяете свою мысль снова и снова. Насколько бы ни была мала вероятность возникновения ДНК случайным образом это не делает искусственное происхождение ДНК более вероятным.
Вы сами себе здесь противоречите. Если случайное возникновение ДНК маловероятно (скажем 1%), то обратно ей пропорциональна неслучайное возникновение: 100% - 1% (случайность) = 99% неслучайность.

Вы же утверждаете, что эти 99% не более вероятны, чем 1% случайности.  :)

почему вы топите за 1% , а не за 99%, что было бы более адекватно?
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 01.09.2020, 12:51:08
Вы сами себе здесь противоречите. Если случайное возникновение ДНК маловероятно (скажем 1%), то обратно ей пропорциональна неслучайное возникновение: 100% - 1% (случайность) = 99% неслучайность.

Вы же утверждаете, что эти 99% не более вероятны, чем 1% случайности.  :)

почему вы топите за 1% , а не за 99%, что было бы более адекватно?

Маловероятно не случайное (естественное) возникновение ДНК вообще, а только тот его вариант, который в настоящее время рассматривается. Однако, ниоткуда не следует, что рассматриваемый механизм естественного возникновения ДНК есть именно тот, вследствие которого она в реальности возникла.  Наука не претендует на всезнание и вполне вероятно, что истинный механизм естественного возникновения ДНК нам просто пока неизвестен (как, скажем, физикам 19 века была неизвестна возможность туннелирования материальной частицы через потенциальный барьер). Таким образом, вывод, что если рассматриваемый механизм естественного возникновения ДНК маловероятен, то, следовательно, единственно возможной альтернативой является не естественное, а искусственное (вследствие действия некоего разумного агента) возникновение ДНК - этот вывод некорректен. Его еще можно было бы рассматривать, если бы существование самого этого разумного агента было бы достоверным фактом. Но единственный известный нам разумный агент - это человек. Но человек явно не является создателем первой ДНК.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 01.09.2020, 16:32:15
Маловероятно не случайное (естественное) возникновение ДНК вообще, а только тот его вариант, который в настоящее время рассматривается.
Евгений тут ключевое слово случайное, оно как раз маловероятным делает событие возникновения ДНК. То как движется молекулы в жидкости это достаточно изученный факт в науке, и то как естественным образом могут собираться от простого к сложному атомы и молекулы в макромолекулы полипептидных и полинуклеотидных цепей белка, РНК и ДНК. То что ученые знают сейчас на основании экспериментов в лаборатории тоже должно было быть и в прошлом. Если событие маловероятно в настоящем, то оно маловероятно и в прошлом.     





Цитировать
Однако, ниоткуда не следует, что рассматриваемый механизм естественного возникновения ДНК есть именно тот, вследствие которого она в реальности возникла.

Теперь ключевое слово естественный, симметрия естественных законов природы относительно сдвига во времени перенести естественные законы природы настоящего в прошлое. 


Цитировать
Наука не претендует на всезнание и вполне вероятно, что истинный механизм естественного возникновения ДНК нам просто пока неизвестен (как, скажем, физикам 19 века была неизвестна возможность туннелирования материальной частицы через потенциальный барьер).
Как раз физический механизм движения и взаимодействия молекул в растворе нам известен достаточно хорошо, чтобы считать святую воду обычной водой. То как естественный механизм собирает полинуклеотидные цепи известен, неизвестен механизм интеллектуальной печати текста, то есть написания генетического романа.   


Цитировать
Таким образом, вывод, что если рассматриваемый механизм естественного возникновения ДНК маловероятен, то, следовательно, единственно возможной альтернативой является не естественное, а искусственное (вследствие действия некоего разумного агента) возникновение ДНК - этот вывод некорректен.
Почему же так, на чем вы основываете своё утверждение?

Цитировать
Его еще можно было бы рассматривать, если бы существование самого этого разумного агента было бы достоверным фактом.
В Египте есть Пирамиды и сфинкс достоверного существования разумного агента создавшего их не существует в настоящем времени,но почем уто мы с некоторой настойчивой уверенностью утверждаем их искусственное происхождение.   


Цитировать
Но единственный известный нам разумный агент - это человек. Но человек явно не является создателем первой ДНК.
Значит что Кто то в прошлом сотворил ДНК и живую клетку и направил её в разумном русле эволюцию.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 03.09.2020, 04:57:25
Маловероятно не случайное (естественное) возникновение ДНК вообще, а только тот его вариант, который в настоящее время рассматривается.
Но, а другие варианты так же основаны на случайности?

Речь вообще-то не о самой молекуле ДНК, ведь она только кислота, а речь о программном обеспечение, о триплетном языке программирования на этой кислоте записанной, о самом тексте этой программы и механизме раскодирования.

ПС. Кстати, триплетный язык ПО на ДНК превосходит двоичную систему созданную человеком по объёму информации на единицу носителя. На ту же длину носителя, триплетным кодом можно записать гораздо больше инфы, чем нашим двоичным. Получается, что та сила, которая всё это организовала, гораздо умнее человека.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 03.09.2020, 10:24:03
Но, а другие варианты так же основаны на случайности?

Кто может знать? Я ведь написал: Наука не претендует на всезнание и вполне вероятно, что истинный механизм естественного возникновения ДНК нам просто пока неизвестен (как, скажем, физикам 19 века была неизвестна возможность туннелирования материальной частицы через потенциальный барьер).

ПС. Кстати, триплетный язык ПО на ДНК превосходит двоичную систему созданную человеком по объёму информации на единицу носителя. На ту же длину носителя, триплетным кодом можно записать гораздо больше инфы, чем нашим двоичным. Получается, что та сила, которая всё это организовала, гораздо умнее человека.

Жаль эта умная сила не создала человеку бескариезных зубов или хотя бы возобновляемых, как у акулы. Казалось бы такая мелочь по сравнению с созданием ДНК. 

Название: Re: Критерии искусственности объекта.
Отправлено: Олег_С от 03.09.2020, 12:30:51

Жаль эта умная сила не создала человеку бескариезных зубов или хотя бы возобновляемых, как у акулы. Казалось бы такая мелочь по сравнению с созданием ДНК.
Сахара не ешьте тогда кариеса не будет. А то всё кто-то вам виноват
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 03.09.2020, 13:02:14
Жаль эта умная сила не создала человеку бескариезных зубов или хотя бы возобновляемых, как у акулы. Казалось бы такая мелочь по сравнению с созданием ДНК.
А кто сказал, что они не возобновляемые? Просто этот механизм включается как правило только один раз. Но он есть.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 03.09.2020, 18:35:56
Кто может знать? Я ведь написал: Наука не претендует на всезнание и вполне вероятно, что истинный механизм естественного возникновения ДНК нам просто пока неизвестен (как, скажем, физикам 19 века была неизвестна возможность туннелирования материальной частицы через потенциальный барьер).
Но этот механизм может быть только двух видов - случайный и не случайный. А какой ещё тип может быть? Туннелирование частиц - это случайный процесс или не случайный?


Жаль эта умная сила не создала человеку бескариезных зубов или хотя бы возобновляемых, как у акулы. Казалось бы такая мелочь по сравнению с созданием ДНК.
Так именно такие зубы и создала. Но ведь первый человек именно этими некариозными зубами съел запретный плод.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 05.09.2020, 18:10:49
Кто может знать? Я ведь написал: Наука не претендует на всезнание и вполне вероятно, что истинный механизм естественного возникновения ДНК нам просто пока неизвестен (как, скажем, физикам 19 века была неизвестна возможность туннелирования материальной частицы через потенциальный барьер).
Вот вот науке неизвестен механизм умной сборки, потому как единственный механизм, который заложен в законах природы это случайный процесс. Даже если предположить что с начало был создана молекулярная печатная машина, по типу пишущей машинки, то проблема в том что сама по себе пишущая машинка не может заниматься литературной деятельностью, точно также для написания кода нужен Программист.

Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 06.09.2020, 18:43:50
Вот вот науке неизвестен механизм умной сборки, потому как единственный механизм, который заложен в законах природы это случайный процесс. Даже если предположить что с начало был создана молекулярная печатная машина, по типу пишущей машинки, то проблема в том что сама по себе пишущая машинка не может заниматься литературной деятельностью, точно также для написания кода нужен Программист.
Тут имеет место некая смысловая путаница. Дело в том, что генетический код это совсем не система условных обозначений, и ни к информации, ни к семантике отношения не имеет. Биологами термин "генетический код" употребляется в значении "patterns".
Таким образом, в биологии генетический код это не "система условных обозначений, которая может быть использована, что бы записывать, сохранять, обрабатывать и передавать информацию", а "повторяющиеся и предсказуемые естественные конфигурации".
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 06.09.2020, 20:13:38
Тут имеет место некая смысловая путаница. Дело в том, что генетический код это совсем не система условных обозначений, и ни к информации, ни к семантике отношения не имеет. Биологами термин "генетический код" употребляется в значении "patterns".
Таким образом, в биологии генетический код это не "система условных обозначений, которая может быть использована, что бы записывать, сохранять, обрабатывать и передавать информацию", а "повторяющиеся и предсказуемые естественные конфигурации".
(https://mypresentation.ru/documents/18ccad1f2260c6eefff657ac3249b1c6/img6.jpg)
Рассмотрим ген. Ген состоит из кодируемых и некодируемых аминокислоты триплетов кодонов, в которых нет "повторяющиеся и предсказуемые естественные конфигурации". В гене строгая заданная смысловая последовательность строго заданных кодонов, место положение каждого кодона строго задана, она определяет каталитические свойства белка. Белок представлен строгой полипептидной последовательностью строго заданных аминокислот. От этой строгой последовательности зависит как скручена и сложена пространственная структура белка, в каких точках третичная структура белка будет иметь активные каталитические центры и как група белков сложится в четверичной структуре биологической машине того или иного фермента. Это как в книге все слова и знаки препинания должны стоять строго на заданном автором месте.
семантические смысловое значение единиц генетического языка это кадони смысловое значение которого кодирование либо аминокислоты, либо знака препинания, смысловое значение гена кодирование белка.
(http://900igr.net/up/datas/207757/016.jpg)
Гено́м — совокупность наследственного материала, заключённого в клетке организма. Геном содержит биологическую информацию, необходимую для построения и поддержания организма.   
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 06.09.2020, 21:01:44
Рассмотрим ген. Ген состоит из кодируемых и некодируемых аминокислоты триплетов кодонов, в которых нет "повторяющиеся и предсказуемые естественные конфигурации". В гене строгая заданная смысловая последовательность строго заданных кодонов,
Осмысленная последовательность с чьей точки зрения? С вашей или с точки зрения химии?
Правильно - с вашей. Вы просто приписываете определённым последовательностям "особый смысл", поскольку результат этих послоедовательностей ("функциональный" с вашей точки зрения белок) имеет для вас "особый смысл". Точно также, как наши предки наделяли особым смыслом гром, молнии, болезни, удачный бросок копья на охоте и прочие явления, природу которых они не понимали, но которые их или пугали или радовали и которые отражались на их жизни.

А у химии (законов природы) нет точки зрения. В химии все соединения "функциональны", поскольку они есть. Химические реакции производят то, что они произвподят потому, что это возможно, а не потому, что это для чего-то нужно. Вы наделяете неодушевлённые природные явления "смыслом", которые они не имеют.
Это всёравно, что утверждать что озоновый слой имеет "функцию" защищать жизнь на Земле от солнечной радиации.
Нет у него никаких функций. Не "закодирован" озоновый слой ни для какой цели. Он просто есть. И как результат того, что он есть и жизнь на Земле существует.
Это вы, у себя в голове, пытаетесь поставить свою "целенаправленную" телегу впереди абсолютно безразличной к каким либо целям лошади-природы.

Точно так же и комбинаторика нуклеотидов. Они будут, посредством химических реакций, соединятся в доступное количество абсолютно равноценных комбинаций.
Тот факт, что одна из этих комбинаций будет иметь качество, которое вы считаете "функциональным" ничего не значит.
Точно так же, температура воды может изменяться на триллионы абсолютно равноценных долей градуса, но вы для себя выделите только те пределы изменения, которые лично вы будете считать "функциональными", поскольку для вас они будут иметь значение, а остальные вы просто не заметите, поскольку на вас они никак не отражаются.
Только и на равноцености долей градуса это никак не отражается.

Так что никакого "кода" направляющего именно в сторону "функциональной" комбинации нет, как нет не зависимого от природы носителя синтаксиса и семантики такого кода. Есть только огромное количество естесвенных химических реакций. Просто если бы эта комбинация не производила то качество, которое она производит, то вас бы не было. Вот и всё.

Я конечно понимаю, что вам хочется выделить именно эту комбинацию из всех возможных, приписав ей особую "функциональность", поскольку вы считаете себя венцом творенья и во всём, что происходит во Вселенной, вы видите целеноправленное движение в направлении создания возможности вашего существования. Точно так же, пикейные жилеты видели во всём, что происходит в мире прелюдию к объявлению Черноморска вольным городом.
Но это проблема вашей ошибочной интуиции. И проблема эта очень распространённая. Люди славятся ошибочными интуициями и страстью к поиску и виденью закономерностей где угодно, включая те места где закононерностей нет. Это проблема человеческая.
Ко Вселенной и законам природы это отношения не имеет.

Ленчик
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 06.09.2020, 21:23:33
Это вы, у себя в голове, пытаетесь поставить свою "целенаправленную" телегу впереди абсолютно безразличной к каким либо целям лошади-природы.

Точно так же и комбинаторика нуклеотидов. Они будут, посредством химических реакций, соединятся в доступное количество абсолютно равноценных комбинаций.
Вполне адекватная, но неполная модель, что понимали ещё в античности, определяя четыре вида причин.

Если отвергать текущие целевые причины, придётся сделать более сильное предположение. О том, что всё мироустойство, включая физические законы, константы, свойства чисел, пространства, времени и т.п. изначально подобраны так, что делают не просто возможным, но необходимым (иначе вероятность нулевая) появление жизни и сознания. Т.е. признать изначальную целевую причину.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 06.09.2020, 21:31:01
Вполне адекватная, но неполная модель, что понимали ещё в античности, определяя четыре вида причин.
Если отвергать текущие целевые причины, придётся сделать более сильное предположение.
Текущие целевые причины? Не понимаю о чем вы.

Цитировать
О том, что всё мироустойство, включая физические законы, константы, свойства чисел, пространства, времени и т.п. изначально подобраны так, что делают не просто возможным, но необходимым (иначе вероятность нулевая) появление жизни и сознания. Т.е. признать изначальную целевую причину.
То же самое. Телега впереди лошади. Вселенная такова, что в ней возможны жизнь и сознание, именно поэтому мы с вами имеем возможность общаться. Но заявлять, что вселенная такова, какая она есть именно затем, что бы мы могли общаться, это очень смелое допущение, не имеющее под собой никаких доказательств. 
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 06.09.2020, 21:48:45
Текущие целевые причины? Не понимаю о чем вы.
У конкретных веществ, например, ферментов. Или у предметов, имеющих функции. Вы же сами пишете о том, что у них нет ни целей (с чем в отношении неживого ещё можно было бы согласиться, хотя и с оговорками) ни даже функций.
Цитировать
То же самое. Телега впереди лошади. Вселенная такова, что в ней возможны жизнь и сознание, именно поэтому мы с вами имеем возможность общаться. Но заявлять, что вселенная такова, какая она есть именно затем, что бы мы могли общаться, это очень смелое допущение, не имеющее под собой никаких доказательств.
Я где-то сказал "затем"? Я говорю, что Ваша позиция предполагает, что (повторюсь, ибо одного раза оказалось недостаточно) всё мироустойство, включая физические законы, константы, свойства чисел, пространства, времени и т.п. изначально подобраны так, что делают необходимым появление жизни и сознания.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 06.09.2020, 22:02:20
У конкретных веществ, например, ферментов. Или у предметов, имеющих функции. Вы же сами пишете о том, что у них нет ни целей (с чем в отношении неживого ещё можно было бы согласиться, хотя и с оговорками) ни даже функций.
Не надо, как говорится обобщать. Если предмет изготовил творец с определенной целью, то о смысле мы говорить можем.
В случае ферментов хочется понять, какие текущие целевые причины у него могут быть?

Цитировать
Я где-то сказал "затем"? Я говорю, что Ваша позиция предполагает, что (повторюсь, ибо одного раза оказалось недостаточно) всё мироустойство, включая физические законы, константы, свойства чисел, пространства, времени и т.п. изначально подобраны так, что делают необходимым появление жизни и сознания.
Разумеется, моя позиция ничего такого не предполагает. С чего, вы такое решили?
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 07.09.2020, 09:06:44
Не надо, как говорится обобщать. Если предмет изготовил творец с определенной целью, то о смысле мы говорить можем.
Т.е. Вы считаете, что наличие функций непременно означает наличие творца?

Цитировать
В случае ферментов хочется понять, какие текущие целевые причины у него могут быть?
У разных конкретных - разные.


Цитировать
Разумеется, моя позиция ничего такого не предполагает. С чего, вы такое решили?
С того, что если бы параметры Вселенной были бы другими, появление жизни в существующей форме было бы невозможным, да и с известными нам параметрами вероятность её появления либо ноль, либо единица (промежуточные значения невозможны). Раз жизнь существует, значит либо она была создана целенаправлено, либо начальные параметры Вселенной влекут её появление с неизбежностью.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 07.09.2020, 09:28:50
Осмысленная последовательность с чьей точки зрения? С вашей или с точки зрения химии?
Правильно - с вашей. Вы просто приписываете определённым последовательностям "особый смысл", поскольку результат этих последовательностей ("функциональный" с вашей точки зрения белок) имеет для вас "особый смысл".
Осмысленная последовательность букв и знаков препинания в тексте осмысленна сточки зрения астора и читателя, которому эта последовательность направлена изначально. Химия и Язык передачи смыслов в тексте не имеют точки сознательной точки зрения точно также как ДНК и книга. Вы тоже приписываете словам языка "особый смысл", а они смысловые единицы, но по своей сути это последовательности знаков фонем, последовательности гласных и согласных звуков в символах, это модулированное колебания воздуха записанное символом на бумаге. Для осмысления нужен наблюдатель, писатель, читатель. Буквы в генетическом языке нуклеотиды, алфавит состоит из 5 букв-нуклеотидов A T G C и U. В русском языке просто бессмысленный набор последовательность букв никакого смысла кроме белиберды не несёт, чтобы появился смысл за набором букв должен стоять определенная осмысленная последовательность букв-звуков, только тогда читатель поймет то, что хотел ему донести автор текста. Генетический текст это не художественное произведение, а техническое, программное обеспечение. Смысловая единица тут триплет-кодон, которому однозначно сопоставлена определенная аминокислота, всего может быть 64 триплета, которые могут кодировать 20 смыслов аминокислот.  Каждая из 20 аминокислот отличается радикалом, то есть находясь строго определенном смысловом месте полипептидной цепи гена строго определенная смыслом аминокислота задают каталитические свойства кодируемого белка, ведь от этой строго заданной смысловой последовательности аминокислот будет зависит вторичная структура белка, от которой будет зависеть как сложится третичная структура, в каких местах произойдет сцепка ниточки вторичной структуры в белковом комочке  третичной структуры, где именно в сложенном третичной структуре белка малом объеме возникнут активные каталитические зоны, а также от смысловой последовательности первичной структуры белка зависит как белки соединяются в четверичной структуре биологические молекулярные машины, зависти как сложатся все эти компоненты в единое пространственное молекулярное устройство, внутри которого возникают каталитические и функциональные центры с определенными свойствами. Все зависти от первичной структуры белка, от того какая аминокислота стоит в том или ином месте полипептидной последовательности, от смысла вложенного Автором.       



Цитировать
Точно также, как наши предки наделяли особым смыслом гром, молнии, болезни, удачный бросок копья на охоте и прочие явления, природу которых они не понимали, но которые их или пугали или радовали и которые отражались на их жизни.
Модест Матвеевич вы до сих пор пытаетесь бороться с громом. Для вам древняя клинопись это поцарапанные глиняные черепки. Точно также как для многих бедуинов древности, то тех пор пока не научились читать эти тексты. Для меня к примеру Китайские иероглифы это детская мазня, калаки-маляки, и что я дурак или китайцы?




Цитировать
А у химии (законов природы) нет точки зрения.
Модест Матвеевич химия это язык физики(природы) в голове Химика. Неграмотный абалдуй не имеет точки зрения так же как неграмотный бедуин не понимает что поцарапанные глиняные таблички у него под ногами это послание его древних предков.   

Цитировать
В химии все соединения "функциональны", поскольку они есть. Химические реакции производят то, что они производят потому, что это возможно, а не потому, что это для чего-то нужно.
Смысл вашего текста смысловая демагогия. мы в тексте излагаем наш смысловой мир. Полипептидная последовательность это смысловая функциональная последовательность в которой заложены функциональные свойства белка. Если изменить на этой последовательности местоположение аминокислоты на другую, изменяются и функциональные свойства белка. Каждое заданное смыслом строгое местоположение строго заданной аминокислоты не потому что это возможно, как говорите вы, а потому, что это для чего-то нужно, для определенных функциональных свойств белка. разберитесь сначала что такое  первичная вторичная третичная и четвертичная структуры белка, и от чего именно зависят  функциональные каталитические свойства белков. От строгой смысловой последовательности первичной структуры белка зависят какие функциональные свойства будуь иметь молекулярные машины четверичной структуры.     
(https://present5.com/docs/primary_structure_1_short_images/primary_structure_1_short_1.jpg)
(https://ds04.infourok.ru/uploads/ex/0474/000079a3-0cc1f3e0/img11.jpg)


(http://Вы наделяете неодушевлённые природные явления "смыслом", которые они не имеют.)Книга неодушевленный предмет, но мы почему то её читаем и извлекаем немало мудрости из оной.


Цитировать
Это всё равно, что утверждать что озоновый слой имеет "функцию" защищать жизнь на Земле от солнечной радиации.
От того в каком месте пространства находится молекула кислорода О3 не зависти её функциональные свойства защитника жизни от ультрафиолета. Это статистические физические свойства озонового слоя.   

(https://cf2.ppt-online.org/files2/slide/r/rNKDOIsoHY40VxyGi8BeURnjwqbQLP3Z6AMTfW/slide-11.jpg)
Цитировать
Нет у него никаких функций. Не "закодирован" озоновый слой ни для какой цели. Он просто есть. И как результат того, что он есть и жизнь на Земле существует.
Это вы, у себя в голове, пытаетесь поставить свою "целенаправленную" телегу впереди абсолютно безразличной к каким либо целям лошади-природы.
это демагогия, причем бессмысленная.

(https://cf.ppt-online.org/files/slide/b/bd0NWFGsm1rT3gMnq82jpY6JwhQXZCaBODi7EK/slide-3.jpg)
Цитировать
Точно так же и комбинаторика нуклеотидов. Они будут, посредством химических реакций, соединятся в доступное количество абсолютно равноценных комбинаций.
какие равноценные комбинации если каждая аминокислота не равноценна, у них различие в радикалах, и от этого различия зависти функциональные свойства белков как раз от строго заданного смыслом места в полипептидной цепи.ю если вы поменяете местами аминокислоты с разными радикалами, то это повлечет изменение пространственной конфигурации третичной и четверичной структуры белка, изменяет каталитические свойства активных центров в пространственной структуре белка, её функциональные свойства.
(https://cf.ppt-online.org/files2/slide/w/wxZOesrP3oCkfnby619uGTJaVzcjgMmU85YRQi/slide-16.jpg)


Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 07.09.2020, 19:52:45
Т.е. Вы считаете, что наличие функций непременно означает наличие творца?
Конечно нет.
Речь о том, что цель может быть только у субъекта. Если нечто, как тот же фермент, возникает просто в результате природных закономерностей, ни о каких целевых причинах мы говорить не можем.

Цитировать
У разных конкретных - разные.
Кто же, позвольте спросить, ставит перед ферментами цели?
Цитировать
С того, что если бы параметры Вселенной были бы другими, появление жизни в существующей форме было бы невозможным, да и с известными нам параметрами вероятность её появления либо ноль, либо единица (промежуточные значения невозможны). Раз жизнь существует, значит либо она была создана целенаправлено, либо начальные параметры Вселенной влекут её появление с неизбежностью.
Рабочая гипотеза, что появление жизни полностью закономерно. И это никак не заставляет делать каких-то необоснованных предположений о существовании каких-то изначальных целевых причин.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 07.09.2020, 20:33:32
Осмысленная последовательность букв и знаков препинания в тексте осмысленна сточки зрения астора и читателя, которому эта последовательность направлена изначально. Химия и Язык передачи смыслов в тексте не имеют точки сознательной точки зрения точно также как ДНК и книга. Вы тоже приписываете словам языка "особый смысл", а они смысловые единицы, но по своей сути это последовательности знаков фонем, последовательности гласных и согласных звуков в символах, это модулированное колебания воздуха записанное символом на бумаге. Для осмысления нужен наблюдатель, писатель, читатель.
Прекрасно, и где же у генетического кода писатель и читатель?

Цитировать
Буквы в генетическом языке нуклеотиды, алфавит состоит из 5 букв-нуклеотидов A T G C и U. В русском языке просто бессмысленный набор последовательность букв никакого смысла кроме белиберды не несёт, чтобы появился смысл за набором букв должен стоять определенная осмысленная последовательность букв-звуков, только тогда читатель поймет то, что хотел ему донести автор текста. Генетический текст это не художественное произведение, а техническое, программное обеспечение.   
Видите ли, любой код( в том значении, в котором его используете вы), и как частный случай текст, это  система условных обозначений.
Вы сможете мне в ДНК показать что-нибудь условное? Если нет, то никакого кода она не содержит.

Цитировать
Смысл вашего текста смысловая демагогия. мы в тексте излагаем наш смысловой мир. Полипептидная последовательность это смысловая функциональная последовательность в которой заложены функциональные свойства белка. Если изменить на этой последовательности местоположение аминокислоты на другую, изменяются и функциональные свойства белка. Каждое заданное смыслом строгое местоположение строго заданной аминокислоты не потому что это возможно, как говорите вы, а потому, что это для чего-то нужно, для определенных функциональных свойств белка.

Когда мы смотрим на определённую последовательность нуклеотидов, мы понимаем, что химическая реакция, которой эта последовательность способствует, произведёт определённый протеин. Правильно? Надеюсь, что ответ будет "да", поскольку это именно так.

Если да, то следующий вопрос.
Могут ли нуклеотиды естественным путём сгруппироваться в последовательность, которая, так сказать, "тупиковая" и не способствует началу химической реакции способствующей образованию протеина?

Если да, то что происходит с подобной "тупиковой" последовательностью?

Вот и весь смысл. :)
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 08.09.2020, 03:03:38
Прекрасно, и где же у генетического кода писатель и читатель?
(https://2.bp.blogspot.com/-mxciMdgdf8Y/XEosQeL8FCI/AAAAAAAAGJI/yhfh0HP8aLgsfIpUaIU6leUPsuk1T0_4ACLcBGAs/s1600/%25D0%25B1%25D0%25B5%25D1%2580%25D0%25B5%25D1%2581%25D1%2582%25D0%25BD%25D0%25B0%25D1%258F%2B%25D0%25B3%25D1%2580%25D0%25B0%25D0%25BC%25D0%25BE%25D1%2582%25D0%25B0.jpg)
где у этой берестяной грамоты писатель?


Цитировать
Видите ли, любой код( в том значении, в котором его используете вы), и как частный случай текст, это  система условных обозначений.
Вы сможете мне в ДНК показать что-нибудь условное? Если нет, то никакого кода она не содержит.
что вы понимаете под словом условное обозначение?
(https://ds04.infourok.ru/uploads/ex/062c/00148c13-d96a6a97/hello_html_487214ce.jpg)
(https://theslide.ru/img/thumbs/f7a9591947fae42985eb388dfb269841-800x.jpg)
 
Цитировать
Когда мы смотрим на определённую последовательность нуклеотидов, мы понимаем, что химическая реакция, которой эта последовательность способствует, произведёт определённый протеин. Правильно? Надеюсь, что ответ будет "да", поскольку это именно так.
ген кодирует белок.


Цитировать
Если да, то следующий вопрос.
Могут ли нуклеотиды естественным путём сгруппироваться в последовательность, которая, так сказать, "тупиковая" и не способствует началу химической реакции способствующей образованию протеина?
(http://images.myshared.ru/5/382229/slide_9.jpg)
Цитировать
Если да, то что происходит с подобной "тупиковой" последовательностью?
Вот и весь смысл. :)
Тупиковая последовательность это что вы подразумеваете?
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 08.09.2020, 12:38:31
Конечно нет.
Речь о том, что цель может быть только у субъекта. Если нечто, как тот же фермент, возникает просто в результате природных закономерностей, ни о каких целевых причинах мы говорить не можем.
Кто же, позвольте спросить, ставит перед ферментами цели?Рабочая гипотеза, что появление жизни полностью закономерно. И это никак не заставляет делать каких-то необоснованных предположений о существовании каких-то изначальных целевых причин.
Может быть у нас разное понимание, что такое цель?


Похоже, что для Вас цель - это то, что кем-то поставлено, задание. Но цель  не обязательно задание, как и наоборот.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 08.09.2020, 14:17:17

Видите ли, любой код( в том значении, в котором его используете вы), и как частный случай текст, это  система условных обозначений.
Вы сможете мне в ДНК показать что-нибудь условное? Если нет, то никакого кода она не содержит.
 

(https://mypresentation.ru/documents/18ccad1f2260c6eefff657ac3249b1c6/img6.jpg)

Условное обозначение смысловой единицы триплет-кодон.  Одна аминокислота кодируется одним триплетом нуклеотидов.  код вырожден, то есть одна аминокислота кодируется более чем одним кодоном.ю кодоны синонимы. Исключение старт-кодон AUG - метионин. Код однозначен каждый кодон кодирует одну аминокислоту.есть грамматические условности, между генами есть знаки препинания старт-кодон и стоп-кодоны. генетические предложения - гены разделены между собой.   Внутри Гена нет знаков препинания это простые предложения, выражающие строго однозначный генетический смысл кодирования белка. неперекрываемость последовательность нуклеотидов имеет рамку считывания по три нуклеотида, один и тот же нуклеотид не может входить одновременно в состав двух или более триплетов.
(https://present5.com/presentation/35612881_437202376/image-15.jpg)

 
Универсальность генетического кода, который, одинаков, одинаковые аминокислоты кодируются одними и теме же триплетами нуклеотидов у всех организмов на земле.
(https://s0.slide-share.ru/s_slide/1f7a16766a537155f8777fbcc420e2b7/36da25d7-3fac-457d-9dcf-5e726314674f.jpeg)   
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 08.09.2020, 14:35:04
Конечно нет.
Речь о том, что цель может быть только у субъекта. Если нечто, как тот же фермент, возникает просто в результате природных закономерностей, ни о каких целевых причинах мы говорить не можем.
Цель есть у архитектора строящего дом. Цели нет у потока воды, который естественным путем промыл в породе пещеру. М дом и пещеру люди использовали под жильё. нуклеотиды это материалы для строительства генетического дома, хотя их очень много виде камней в пещере. ДНК, РНк и ферменты это четко обработанные строительные материалы и приспособления для постройки архитектурного шедевра, а нуклеотиды и аминокислоты это всего лишь обработанные строительные материалы, и обработать их могла природа, вот только для строительства не все природные материалы годятся, пространственная симметрия понимаете ли учитывается архитектором хиральность. Возникший фермент должен обладать правильными каталитическим свойствами, чтобы вписаться в общую архитектуру.   



Цитировать
Кто же, позвольте спросить, ставит перед ферментами цели?Рабочая гипотеза, что появление жизни полностью закономерно. И это никак не заставляет делать каких-то необоснованных предположений о существовании каких-то изначальных целевых причин.
Тот кто суммирует все каталитические свойства в единый работающий живой организм.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 08.09.2020, 21:08:46
Цель есть у архитектора строящего дом.
Однозначно.

Цитировать
Цели нет у потока воды, который естественным путем промыл в породе пещеру.
А вот это спорно. У воды нет цели промыть жилище для людей, но можно сказать, что её цель - приобрести меньший гравитационный потенциал.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 08.09.2020, 21:17:49
где у этой берестяной грамоты писатель?
Это писал человек. Полагать нечто иное нет ни малейших оснований. Люди до сих пор пишут письма, правда не на бересте, но не суть.

Кстати прекрасно видны условные знаки. А в ДНК можете показать условные знаки? А указать на автора ДНК, можете? 

Цитировать
что вы понимаете под словом условное обозначение?
То же, что и все.
Знак — соглашение (явное или неявное) о приписывании чему-либо какого-либо определённого смысла, значения.
https://ru.wikipedia.org/wiki/%D0%97%D0%BD%D0%B0%D0%BA
Так вот, система таких знаков и будет кодом.

Смотрите, если вы говорите о ДНК, как о коде (системе условных обозначений), вы должны показать эти условные знаки в ДНК.
Цитировать
Условное обозначение смысловой единицы триплет-кодон.
Нужно показать не условное обозначение триплета, а условные обозначения непосредственно в ДНК.

Итак, повтораю вопрос.
Где вы видели в молекуле ДНК условные символы которых нет в другиx молекулах?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 08.09.2020, 21:19:54
Может быть у нас разное понимание, что такое цель?
Похоже, что для Вас цель - это то, что кем-то поставлено, задание. Но цель  не обязательно задание, как и наоборот.
Во всех словарях, в которые я заглядывал, цель неразрывно связана с субъектом.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 08.09.2020, 21:27:15
Во всех словарях, в которые я заглядывал, цель неразрывно связана с субъектом.
Что это за словари? Почему они игнорируют Аристотеля, средневековую и новоевропейскую философию, современную теорию систем и т.п.?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 08.09.2020, 21:56:16
Что это за словари? Почему они игнорируют Аристотеля, средневековую и новоевропейскую философию, современную теорию систем и т.п.?
Словари Даля, Ожегова, Ушакова, Большой Советский Энциклопедический.

А почему они должны равняться на древнегреческого телеолога или на какой-то раздел науки? Словари, если вы вдруг не знаете, фиксируют современное им состояние языка, не более того.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 08.09.2020, 23:06:11
Словари Даля, Ожегова, Ушакова, Большой Советский Энциклопедический.

А почему они должны равняться на древнегреческого телеолога или на какой-то раздел науки? Словари, если вы вдруг не знаете, фиксируют современное им состояние языка, не более того.
Если мы исходим из употребления слов публикой, а не в научном или философском контексте, то зачем тогда это бытовое употребление применять для доказательства философских или научных утверждений?
Да и не уверен я, что авторы словарей, тот же Даль, из текста которого этого не следует, специально подчёркивают субъективность цели.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 09.09.2020, 13:49:18
Это писал человек. Полагать нечто иное нет ни малейших оснований. Люди до сих пор пишут письма, правда не на бересте, но не суть.

вы можете предоставить хотя бы фотографию этого человека что написал? Этого человека не существует.

Цитировать
Кстати прекрасно видны условные знаки.
я вижу только поцарапанную бересту реальные осязаемые борозды на поверхности бересты.
 
Цитировать
А в ДНК можете показать условные знаки? А указать на автора ДНК, можете?
вы же видите в последовательности ДНК цепочка нуклеотидов, и я вижу последовательности физических царапин. конечно мы можем каждой группе царапин сопоставить буквенный знак и звук, и прочитать  последовательность, но также мы группе атомов образующих молекулу можем поставить знак  A, C, G, T и U. это делают люди для удобства. 
То же, что и все.
Цитировать
Знак — соглашение (явное или неявное) о приписывании чему-либо какого-либо определённого смысла, значения.
https://ru.wikipedia.org/wiki/%D0%97%D0%BD%D0%B0%D0%BA
Так вот, система таких знаков и будет кодом.

(https://theslide.ru/img/thumbs/f7a9591947fae42985eb388dfb269841-800x.jpg)
Смотрите, если вы говорите о ДНК, как о коде (системе условных обозначений), вы должны показать эти условные знаки в ДНК.Нужно показать не условное обозначение триплета, а условные обозначения непосредственно в ДНК. так все условные обозначения придуманы людьми для удобства. математика инструмент для познания природы, там сплошные условные обозначения, так же и физика это сплошные условные обозначения, всё это для удобства понимания, Вселенная не состоит из условных обозначений, она просто есть, но для её изучения мы используем условные обозначения. 

Цитировать
Итак, повтораю вопрос.
Где вы видели в молекуле ДНК условные символы, которых нет в других молекулах?
В каких молекулах присутствуют эти условности кроме ДНЕ и РНК?
(https://mypresentation.ru/documents/18ccad1f2260c6eefff657ac3249b1c6/img6.jpg)
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 09.09.2020, 20:30:55
Если мы исходим из употребления слов публикой, а не в научном или философском контексте, то зачем тогда это бытовое употребление применять для доказательства философских или научных утверждений?
Наверное не стоит, так категорично говорить за всю науку и философию в придачу. Теория систем это далеко не вся наука.
А, если мы откроем философский словарь, то первое определение цели будет неразрывно связанно с субъектом, а потом уже пойдет история философских возрений на это понятие.
цель. новый философский словарь (https://filpedia.ru/357/#:~:text=%D0%A6%D0%95%D0%9B%D0%AC%20%E2%80%94%20%D0%B8%D0%B4%D0%B5%D0%B0%D0%BB%D1%8C%D0%BD%D1%8B%D0%B9%20%D0%B8%D0%BB%D0%B8%20%D1%80%D0%B5%D0%B0%D0%BB%D1%8C%D0%BD%D1%8B%D0%B9%20%D0%BF%D1%80%D0%B5%D0%B4%D0%BC%D0%B5%D1%82,%D1%84%D0%B8%D0%BB%D0%BE%D1%81%D0%BE%D1%84%D0%B8%D0%B8%20%D0%BD%D0%B0%D1%87%D0%B8%D0%BD%D0%B0%D1%8F%20%D1%81%20%D1%8D%D0%BF%D0%BE%D1%85%D0%B8%20%D0%A1%D0%BE%D0%BA%D1%80%D0%B0%D1%82%D0%B0.)

Цитировать
Да и не уверен я, что авторы словарей, тот же Даль, из текста которого этого не следует, специально подчёркивают субъективность цели.
Значение слова ЦЕЛЬ в Словаре Даля:
Конечное желанье, стремленье, намеренье, чего кто силится достигнуть

(пожимает плечами)
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 09.09.2020, 20:56:46
вы можете предоставить хотя бы фотографию этого человека что написал? Этого человека не существует.
Оставьте свой юношеский максимализм.

Цитировать
я вижу только поцарапанную бересту реальные осязаемые борозды на поверхности бересты.
Я тоже. Это потому, что мы с вами не знаем данного кода. Но, скорее всего, это код уверяю вас, вы может быть знаете из книг и фильмов, что люди еще совсем недавно пользовались таким средством коммуникации, передавали друг другу предметы испещренные символами. Мне и самому в детстве довелось писать такие, правда не на бересте, а на бумаге. Так, что это точно условные знаки.
Далее. Мы с вами можем пойти в лес, целый день изучать бересту на деревьях и ничего подобного не найдем. То есть естественным образом такой предмет возникнуть не мог.

Цитировать
вы же видите в последовательности ДНК цепочка нуклеотидов, и я вижу последовательности физических царапин. конечно мы можем каждой группе царапин сопоставить буквенный знак и звук, и прочитать  последовательность, но также мы группе атомов образующих молекулу можем поставить знак  A, C, G, T и U. это делают люди для удобства. 
Еще раз. Я вас не спрашиваю, как последовательность нуклеотидов условно изображается в учебнике. Я вас спрашиваю, где в самой ДНК условные обозначения? Ведь, если ДНК код, то такие обозначения там непременно должны быть.

Цитировать
В каких молекулах присутствуют эти условности кроме ДНЕ и РНК?
То, что вы показываете это химические свойства молекул ДНК и РНК, что в них условного?

Понимание того, какими будут действия нуклеотидов при наличии определённого их групирования, ничем не отличается от понимания того, что сделает потасиум при наличии воды или вода при наличии минусовой температуры.
Везде и во всём как только мы имеем последовательность - при наличии этого, делается то и так - мы имеем подчинение правилам. Если вы хотите называть эти правила кодом, то называйте на здоровье. Сути это не меняет.

Но если вы хотите сказать, что ДНК - это код, то и любая молекула во Вселенной - это код.
Код демонстрирующий постоянство законов природы, им подчиняющийся и не нуждающийся ни в каких разумных создателях.
Никакой исключительностью, в этом смысле,ДНК не обладает.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 10.09.2020, 07:45:54

Но если вы хотите сказать, что ДНК - это код, то и любая молекула во Вселенной - это код.

Вообще-то это наука говорит, что программа записанная в ДНК - это код. Будете с наукой спорить?

А про то, что каждая молекула Вселенной - код, говорите только вы, а наука об этом молчит. Почему так?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 10.09.2020, 07:57:11

Еще раз. Я вас не спрашиваю, как последовательность нуклеотидов условно изображается в учебнике. Я вас спрашиваю, где в самой ДНК условные обозначения? Ведь, если ДНК код, то такие обозначения там непременно должны быть.

Вы видимо понимаете "условное обозначение" в узком смысле, как исключительно нарисованные знаки на бумаге или на другом носителе. А сможете пошире посмотреть? Если эти знаки не в виде нарисованных линий, а в другом виде представлены? Вот дырочки в перфоленте, кодирующее размеры и форму детали, будут являться "условным обозначением" размера и формы детали? А вместо этих дырочек, электрический код в виде 010001001 на жёстком диске будет являться "условным обозначением" размера и формы детали?

Или код Морзе будет являться "условным обозначением" слов? Тем более этот код не пишется, а настукивается любым предметом о другой предмет. 
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 10.09.2020, 08:09:10

Значение слова ЦЕЛЬ в Словаре Даля:
Конечное желанье, стремленье, намеренье, чего кто силится достигнуть

(пожимает плечами)
И если мы вдруг замечаем, что у какого-то природного объекта есть цели, то делаем вывод, что есть кто-то, кто силился этого достигнуть?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 10.09.2020, 14:55:34
Оставьте свой юношеский максимализм.
Юноша, если вы смотря на бересту, видите что эти царапины это не просто царапины, а упорядоченный текст, написанный разумным субъектом, которого нет, но вы понимаете что он был, потому что кроме человека эти царапины никто не мог нанести в таком порядке, потому что там есть смысл и послание из прошлого, которое вы умеете читать. ДНК это тоже послание из прошлого, которое люди учатся читать. В нем молекулы могут быть обозначены условными обозначениями с однозначным смыслом. эти смыслы мы читаем и понимаем. понимаем мы не как эмоционально насыщенный роман, а строго логическая программа, ведущая от простого к сложному процесс формирования и функционирования живого организма. Азбука Морза использует точку и тере, но кто вам запретить использовать для передачи информации белую зелену и синюю бусинки, третья пусть обозначает пробел, нанизывайте бусинки в порядке Азбуки Морза и пишите текст.         


Цитировать
Я тоже. Это потому, что мы с вами не знаем данного кода. Но, скорее всего, это код уверяю вас, вы может быть знаете из книг и фильмов, что люди еще совсем недавно пользовались таким средством коммуникации, передавали друг другу предметы испещренные символами. Мне и самому в детстве довелось писать такие, правда не на бересте, а на бумаге. Так, что это точно условные знаки.
точно также нуклеотиды, триплеты-кодоны и гены это тоже условные знаки, они однозначно обусловлены. Буква и нуклеотид не чем не отличаются в смысли обусловленности, буква это геометрическая фигура состоящая из линий и точек выстроенным в особом порядке, тоже нуклеотид это молекула фигура с определенными однозначными свойствами.   


Цитировать
Далее. Мы с вами можем пойти в лес, целый день изучать бересту на деревьях и ничего подобного не найдем. То есть естественным образом такой предмет возникнуть не мог.
так и на Марсе мы ДНК не найдем, хотя там когда то текли реки. Я вам много раз указывал на симметрию законов природы относительно сдвига в пространстве и времени, физические и химические процессы в одних и тех же условиях идут по тем же правилам не зависимо где находится лужа и в прошлом, настоящим иди будущем, законы одни и те же, если конечно не нарушить закон сохранения материи энергии. Жизнь случайно не могла возникнуть и развиться под за такое очень короткое время, легче в лесу куда не когда не вступала нога человека найти подобные берестяные грамоты.   

Цитировать
Еще раз. Я вас не спрашиваю, как последовательность нуклеотидов условно изображается в учебнике. Я вас спрашиваю, где в самой ДНК условные обозначения? Ведь, если ДНК код, то такие обозначения там непременно должны быть.
возьмите учебник общей биологии и посмотрите, как люди для удобства используют однозначные условные обозначения, им так удобно обозначать, но эти точно отражают то как обозначение последовательность нуклеотидов божественны Разум.
(https://cf.ppt-online.org/files/slide/c/COQdvhV5ePxRFyoSl6ZIp241KUGX9qnM3jNYEw/slide-12.jpg) Условные обозначения нуклеотидов в последовательности со свойством комплементарности. 
Цитировать
То, что вы показываете это химические свойства молекул ДНК и РНК, что в них условного?
Однозначная обусловленность свойств. 

Цитировать
Понимание того, какими будут действия нуклеотидов при наличии определённого их группирования, ничем не отличается от понимания того, что сделает потасиум при наличии воды или вода при наличии минусовой температуры.
Везде и во всём как только мы имеем последовательность - при наличии этого, делается то и так - мы имеем подчинение правилам. Если вы хотите называть эти правила кодом, то называйте на здоровье. Сути это не меняет.
Вы пытаетесь не признавать очевидные общепризнанные научные факты, весь строй идет в ногу кроме вас, и вы всех остальных обвиняете что они иуду не вного, только вы идёте в ногу. 
(https://theslide.ru/img/thumbs/f7a9591947fae42985eb388dfb269841-800x.jpg)
(https://mypresentation.ru/documents/18ccad1f2260c6eefff657ac3249b1c6/img6.jpg)
Цитировать
Но если вы хотите сказать, что ДНК - это код, то и любая молекула во Вселенной - это код.
по отношению к ДНК не любая, их всего 5 нуклеотидов и 20 аминокислот. Единица кода кодон-триплет однозначно кодирующий только одну аминокислоту. Посмотрите на свойства генетического кода.


Цитировать
Код демонстрирующий постоянство законов природы, им подчиняющийся и не нуждающийся ни в каких разумных создателях.
Никакой исключительностью, в этом смысле,ДНК не обладает.
законы природы достаточно просты это движение и взаимодействие, днк им подчиняется ровно столько же как книга, компьютер, да всё во вселенной, вот только текст или видео в книги или компьютере это продукт разума, которым наделен человек, так вот при постоянстве законов природы без разума ни книга, ни компьютер ни сам человек как биологическая машина невозможен, нужен творческий разум.       
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 10.09.2020, 18:20:37
Значение слова ЦЕЛЬ в Словаре Даля:
Конечное желанье, стремленье, намеренье, чего кто силится достигнуть

(пожимает плечами)
Из всей статьи выбрали одну фразу?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 10.09.2020, 19:59:58
Из всей статьи выбрали одну фразу?
Значение слова ЦЕЛЬ в Словаре Даля:
Конечное желанье, стремленье, намеренье, чего кто силится достигнуть.

бог творит жизнь от простого к сложному. Наука тоже утверждает эволюция так и развивалась. Ц природы нет цели, там процессы идут от простого к сложному и обратно от сложного к простому. Спонтанно достичь высокого уровня сложности организации материи достаточно проблематично если сказать невозможно. для этого нужен разум и инженерное искусство. Атомы спонтанно соединяются в простые молекулы такие как нуклеотиды и аминокислоты, а из простых молекул собираются макромолекулы такие как ДНК, РНК и Белки и на этом этапе спонтанность сборки заканчивается, появляется генетический код и программное обеспечение направленной эволюции. Разумное редактирование програмного обеспечения превращает простые самовоспроизводящиеся автоматы в сложные, создаются множество разнообразных молекулярных машин строящих на базе програмного обеспечения разнообразные биологические организмы. Редактирование программы наука называет мутациями и отбором,но мутации спонтанны, поэтому нужен механизм естественного отбора мух от котлет. Но наука не знает переходных форм и отброшенного мусора, а редактирование программы превращает одну форму жизни в другую приспосабливая её к изменившейся внешней среде. В космосе в кислород и углерод связан в молекулы углекислого газа, по этому при формировании планеты земля её атмосфера избыточествовала углекислым газом, поэтому первая жизнь создана была зеленой, запустившей процесс фотосинтеза. Дальше по мере обогащения среды кислородом постепенно  и последовательно редактировалось программа жизни, адаптируя формы жизни под изменяющиеся условия среды обитания.       
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 10.09.2020, 21:29:04
Вообще-то это наука говорит, что программа записанная в ДНК - это код. Будете с наукой спорить?
Видите ли, информация, программа, алфавит, язык/код по отношению к ДНК это всего лишь аналогии для понимания суперсложных последовательностей и закономерностей химических реакций.

Программа в ДНК это последовательность реакций обусловленная химическими свойствами молекулы. Ни к каким языкам программирования, в смысле системы условных обозначений, это отношения не имеет. По крайней мере пока эти условные обозначения не будут в ДНК представленны.

Тоже самое код, имеется в виду не система условных обозначений, а в значении ,pattern то есть повторяющиеся и предсказуемые естественные конфигурации. 
А соответственно, и программист нам без надобности.
Цитировать
А про то, что каждая молекула Вселенной - код, говорите только вы, а наука об этом молчит. Почему так?
Потому, что это прямо логически вытекает из ваших попыток поймать науку на слове. Потому, что в плане кода, как системы условных обозначение, ДНК ничем не отличается от любой другой молекулы.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 10.09.2020, 21:42:44
Вы видимо понимаете "условное обозначение" в узком смысле, как исключительно нарисованные знаки на бумаге или на другом носителе. А сможете пошире посмотреть? Если эти знаки не в виде нарисованных линий, а в другом виде представлены? Вот дырочки в перфоленте, кодирующее размеры и форму детали, будут являться "условным обозначением" размера и формы детали? А вместо этих дырочек, электрический код в виде 010001001 на жёстком диске будет являться "условным обозначением" размера и формы детали?
Или код Морзе будет являться "условным обозначением" слов? Тем более этот код не пишется, а настукивается любым предметом о другой предмет.
Дык, я и жду от вас ответа, что же является условными знаками в ДНК?
Где вы видели в молекуле ДНК условные символы которых нет в другиx молекулах?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 10.09.2020, 21:43:57
И если мы вдруг замечаем, что у какого-то природного объекта есть цели, то делаем вывод, что есть кто-то, кто силился этого достигнуть?
Были замечены такие "целевые" природные объекты?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 10.09.2020, 22:16:39
Юноша, если вы смотря на бересту, видите что эти царапины это не просто царапины, а упорядоченный текст, написанный разумным субъектом, которого нет, но вы понимаете что он был, потому что кроме человека эти царапины никто не мог нанести в таком порядке, потому что там есть смысл и послание из прошлого, которое вы умеете читать.

Что если? После "если" должно идти "то".

Цитировать
ДНК это тоже послание из прошлого, которое люди учатся читать.
Почему? Аналогия с берестой не работает. В случае с берестой мы прекрасно знаем агента, который нанес знаки и эти знаки мы видим. В случае ДНК, мы не знаем агента способного сотворить такое и не видим никаких условных знаков, то есть нет никакого основания говорить о ДНК как о системе условных обозначений (коде).
Все, что мы видим это реакции, которые протекают в полном соответствии с законами химии.

Цитировать
В нем молекулы могут быть обозначены условными обозначениями с однозначным смыслом.
Осмысленная последовательность с чьей точки зрения? С вашей или с точки зрения химии?
Правильно - с вашей. Вы просто приписываете определённым последовательностям "особый смысл", поскольку результат этих послоедовательностей ("функциональный" с вашей точки зрения белок) имеет для вас "особый смысл". Точно также, как наши предки наделяли особым смыслом гром, молнии, болезни, удачный бросок копья на охоте и прочие явления, природу которых они не понимали, но которые их или пугали или радовали и которые отражались на их жизни.

А у химии (законов природы) нет точки зрения. В химии все соединения "функциональны", поскольку они есть. Химические реакции производят то, что они произвподят потому, что это возможно, а не потому, что это для чего-то нужно. Вы наделяете неодушевлённые природные явления "смыслом", которые они не имеют.
Это всёравно, что утверждать что озоновый слой имеет "функцию" защищать жизнь на Земле от солнечной радиации.
Нет у него никаких функций. Не "закодирован" озоновый слой ни для какой цели. Он просто есть. И как результат того, что он есть и жизнь на Земле существует.
Это вы, у себя в голове, пытаетесь поставить свою "целенаправленную" телегу впереди абсолютно безразличной к каким либо целям лошади-природы.

Точно так же и комбинаторика нуклеотидов. Они будут, посредством химических реакций, соединятся в доступное количество абсолютно равноценных комбинаций.
Тот факт, что одна из этих комбинаций будет иметь качество, которое вы считаете "функциональным" ничего не значит.
Точно так же, температура воды может изменяться на триллионы абсолютно равноценных долей градуса, но вы для себя выделите только те пределы изменения, которые лично вы будете считать "функциональными", поскольку для вас они будут иметь значение, а остальные вы просто не заметите, поскольку на вас они никак не отражаются.
Только и на равноцености долей градуса это никак не отражается.

Так что никакого "кода" направляющего именно в сторону "функциональной" комбинации нет, как нет не зависимого от природы носителя синтаксиса и семантики такого кода. Есть только огромное количество естесвенных химических реакций. Просто если бы эта комбинация не производила то качество, которое она производит, то вас бы не было. Вот и всё.

Я конечно понимаю, что вам хочется выделить именно эту комбинацию из всех возможных, приписав ей особую "функциональность", поскольку вы считаете себя венцом творенья и во всём, что происходит во Вселенной, вы видите целеноправленное движение в направлении создания возможности вашего существования. Точно так же, пикейные жилеты видели во всём, что происходит в мире прелюдию к объявлению Черноморска вольным городом.
Но это проблема вашей ошибочной интуиции. И проблема эта очень распространённая. Люди славятся ошибочными интуициями и страстью к поиску и виденью закономерностей где угодно, включая те места где закононерностей нет. Это проблема человеческая.
Ко Вселенной и законам природы это отношения не имеет.

Ленчик
Цитировать
эти смыслы мы читаем и понимаем. понимаем мы не как эмоционально насыщенный роман, а строго логическая программа, ведущая от простого к сложному процесс формирования и функционирования живого организма.
Понимаем мы вовсе не смыслы, а закономерности соответствия определенных нуклеотидов в ДНК определенным белкам.

Цитировать
Азбука Морза использует точку и тере, но кто вам запретить использовать для передачи информации белую зелену и синюю бусинки, третья пусть обозначает пробел, нанизывайте бусинки в порядке Азбуки Морза и пишите текст.
 точно также нуклеотиды, триплеты-кодоны и гены это тоже условные знаки, они однозначно обусловлены. 
 
Ничего подобного о нуклеотиде сказать нельзя.
Как вы предлагаете фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?

Цитировать
Буква и нуклеотид не чем не отличаются в смысли обусловленности, буква это геометрическая фигура состоящая из линий и точек выстроенным в особом порядке, тоже нуклеотид это молекула фигура с определенными однозначными свойствами.   
На самом деле буква это условный знак, о значении которого кто-то с кем-то договорился.

Цитировать
А по вашей "логике" любая молекула ничем не отличается от буквы в смысле обусловленности, а не только нуклеотид.
так и на Марсе мы ДНК не найдем, хотя там когда то текли реки.
Ничего не значит.
Цитировать
Жизнь случайно не могла возникнуть и развиться под за такое очень короткое время, легче в лесу куда не когда не вступала нога человека найти подобные берестяные грамоты.   
Это голословно.
А с помощью какого жульничества, вы это пытаетесь доказать, на форуме все уже убедились.
Цитировать
возьмите учебник общей биологии и посмотрите, как люди для удобства используют однозначные условные обозначения, им так удобно обозначать, но эти точно отражают то как обозначение последовательность нуклеотидов божественны Разум.
Какой ваш родной язык? Очевидно, что не русский.

Цитировать
Вы пытаетесь не признавать очевидные общепризнанные научные факты, весь строй идет в ногу кроме вас, и вы всех остальных обвиняете что они иуду не вного, только вы идёте в ногу. 
Единица кода кодон-триплет однозначно кодирующий только одну аминокислоту. Посмотрите на свойства генетического кода.
Моя сентенция такая:

Система передачи информации при помощи знаков и символов требует знаков и символов (знакомых буковок).
Иначе, это не имеет отношения к системе передачи информации при помощи знаков и символов.

Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 10.09.2020, 22:22:22
Из всей статьи выбрали одну фразу?
Я выбрал определение. Определение это главное, дальше идут примеры.

Покажите пожалуйста, какие примеры из этой статьи заставили вас сомневаться в субъективном характере понятия "цель" по Далю.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 11.09.2020, 06:11:04
Были замечены такие "целевые" природные объекты?
Множество. Например электрон, протон и нейтрон - их цель создавать атомы. Уберите хотя бы 1 и вселенной не будет. Или бозон Хиггса - его цель создавать массу, искривлять пространство-время. Уберите этот бозон и будет пыль вместо вселенной.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 11.09.2020, 20:05:43
Я выбрал определение. Определение это главное, дальше идут примеры.

Покажите пожалуйста, какие примеры из этой статьи заставили вас сомневаться в субъективном характере понятия "цель" по Далю.
Вы вроде выступали не за научное или философское понимание, а за употребление в языке. А оно имеет широкий спектр и не сводится к определению.

Цель пули или стрелы (по-моему упоминается у Даля, гуглить лень) разве предполагает конкретного стрелка? Стрелок может быть любым, а цель остаётся целью.

Если говорить о греках, то τέλος (цель, конец, завершение) это состояние самого предмета, а не кого-то внешнего.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 11.09.2020, 20:24:13
Дык, я и жду от вас ответа, что же является условными знаками в ДНК?
Где вы видели в молекуле ДНК условные символы которых нет в другиx молекулах?
Дык, для начала мы должны понять, что вы подразумеваете под "условными знаками и символами". Для этого и задаю уточняющие вопросы: дырки в перфоленте по которым станок изготавливал деталь например, будут являться "условными знаками и символами" размера и формы этой детали и последовательности её изготовления? 

А заряженные и пустые электрические ячейки 01001001 дающие так же программу изготовления детали для станка ЧПУ  будут являться "условными знаками и символами" размера и формы этой детали и последовательности её изготовления?

А сигналы Морзе хоть постукиванием, хоть помигиванием лампой, будут являться "условными знаками и символами" букв и слов?

Ну и наконец, форма, пропорции и размеры вашего носа и ушей, как-то условно закодированы в коде ДНК?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 11.09.2020, 22:39:30
Множество. Например электрон, протон и нейтрон - их цель создавать атомы.
Да? А с чего вы решили?
Да, у электронов есть такое свойство ну и что. На каком основании, вы это свойство объявляете целью?
Вот, у человека есть свойство, например, потеть. Выделение пота является целью человека?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 11.09.2020, 22:54:13
Вы вроде выступали не за научное или философское понимание, а за употребление в языке.
Я выступал и выступаю, единственно за использование одинаковых определений у высоких разговаривающих сторон.

Но раз зашла речь, то значение слова "цель" в абсолютном большинстве научных дисциплин то самое словарное, подразумевающее субъекта.
И в философском словаре первым идет такое же определение, а потом уже где-то там в статье говорится о взглядах Аристотеля и иже с ним. 

Цитировать
А оно имеет широкий спектр и не сводится к определению.
О как! Как это не сводится?
Неправильное употребление понятий или выдумывание им новых, ранее не употреблявшихся, значений неминуемо ведет к путанице. Что, мы с вами на нашем примере и наблюдали.
Цитировать
Цель пули или стрелы (по-моему упоминается у Даля, гуглить лень) разве предполагает конкретного стрелка? Стрелок может быть любым, а цель остаётся целью.
Я не рассматривал вариант "цель", как синоним "мишени", как заведомо не подходящий к нашему контексту.
Цитировать
Если говорить о греках, то τέλος (цель, конец, завершение) это состояние самого предмета, а не кого-то внешнего.
Кто из нас, я извиняюсь, грек?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 11.09.2020, 23:26:15
Дык, для начала мы должны понять, что вы подразумеваете под "условными знаками и символами".
Тоже, что и все:
Знак — соглашение (явное или неявное) о приписывании чему-либо какого-либо определённого смысла, значения.
Знак вики (https://ru.wikipedia.org/wiki/%D0%97%D0%BD%D0%B0%D0%BA)

Цитировать
Для этого и задаю уточняющие вопросы: дырки в перфоленте по которым станок изготавливал деталь например, будут являться "условными знаками и символами" размера и формы этой детали и последовательности её изготовления? 
А заряженные и пустые электрические ячейки 01001001 дающие так же программу изготовления детали для станка ЧПУ  будут являться "условными знаками и символами" размера и формы этой детали и последовательности её изготовления?
А сигналы Морзе хоть постукиванием, хоть помигиванием лампой, будут являться "условными знаками и символами" букв и слов?
Конечно будут.
Цитировать
Ну и наконец, форма, пропорции и размеры вашего носа и ушей, как-то условно закодированы в коде ДНК?
Условно нет, по крайней мере, пока вы эту условность мне не покажете.

Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 12.09.2020, 10:14:57
Тоже, что и все:
Знак — соглашение (явное или неявное) о приписывании чему-либо какого-либо определённого смысла, значения.
Знак вики (https://ru.wikipedia.org/wiki/%D0%97%D0%BD%D0%B0%D0%BA)
Конечно будут.Условно нет, по крайней мере, пока вы эту условность мне не покажете.

что вам непонятно, знак в генетическом коде кадони условное соглашение обозначающие смысловую единицу генетического кода. слово произнесенное это модулированные звуковые колебания созданными связками и геометрией отверстия ротовой полости, которым ставится по соглашению знаковая форма слова записаного знаками. звук это физическое явление, а записанное буквами слово это знаковая форма созданная человеком. Для описания физических явлений человек использует математику как систему знаков. Вы отрицаете то что уже общепринято в науке.         
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 12.09.2020, 10:56:01

Что если? После "если" должно идти "то".
замените в уме но на то.

Цитировать
Почему? Аналогия с берестой не работает. В случае с берестой мы прекрасно знаем агента, который нанес знаки и эти знаки мы видим. В случае ДНК, мы не знаем агента способного сотворить такое и не видим никаких условных знаков, то есть нет никакого основания говорить о ДНК как о системе условных обозначений (коде).
в обоих случаях мы не знаем автора текста, он был в далеком прошлом, знаем что автор не был белкой. с высокой долей вероятности мы можем говорить что это был человек. все условные знаки придумывает для удобства человек в своём разуме, слово это модулированный звук, который человек записывает с помощью последовательности букв, буквы кодируют гласные и согласные звуки фонемы. Фонема (др.-греч. φώνημα «звук») — минимальная смыслоразличительная единица языка. Фонема не имеет самостоятельного лексического или грамматического значения, но служит для различения и отождествления значимых единиц языка (морфем и слов). так вот смыслоразличительная единица генетического языка это нуклеотид, она различается азотистыми основаниями их 5. Слово в генетическом языке это триплет кодон кодирующий однозначно одну аминокислоту или знак препинания.

Цитировать
Все, что мы видим это реакции, которые протекают в полном соответствии с законами химии.
Осмысленная последовательность с чьей точки зрения? С вашей или с точки зрения химии?
химия  как и математика с физикой это точка зрения человека на природу вещей, и законы это математические соотношения между условными знаками, которое человек накладывает на выявленные и систематизированные природные феномены, сопоставляя феномену условный знак, который в голове человека.


Цитировать
Правильно - с вашей. Вы просто приписываете определённым последовательностям "особый смысл", поскольку результат этих последовательностей ("функциональный" с вашей точки зрения белок) имеет для вас "особый смысл".
особый функциональный смысл.

Цитировать
Точно также, как наши предки наделяли особым смыслом гром, молнии, болезни, удачный бросок копья на охоте и прочие явления, природу которых они не понимали, но которые их или пугали или радовали и которые отражались на их жизни.
а это эмоциональный смысл, понимаете разницу в словосочетаниях, общее у них в слове смысл, функциональный смысл прописан в технологических картах, а эмоциональный в восторгах или страхах.
Цитировать
А у химии (законов природы) нет точки зрения. В химии все соединения "функциональны", поскольку они есть. Химические реакции производят то, что они производят потому, что это возможно, а не потому, что это для чего-то нужно. Вы наделяете неодушевлённые природные явления "смыслом", которые они не имеют.
точка зрения у наблюдателя этих законов, у химика. природа функционирует по правилам заданным ей из вне.

Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 12.09.2020, 11:46:17
Я выступал и выступаю, единственно за использование одинаковых определений у высоких разговаривающих сторон.
Поэтому я и уточнил. Так оно и оказалось: смысл, который вкладываете в "цель" Вы, как минимум уже, а как максимум - вообще не пересекается с научным и философским пониманием, которым стараемся следовать мы с Александром.

Цитировать
Но раз зашла речь, то значение слова "цель" в абсолютном большинстве научных дисциплин то самое словарное, подразумевающее субъекта.
Тогда надо конкретизировать, в каких дисциплинах, а также уточнить понятие субъекта.


Цитировать
О как! Как это не сводится?
Неправильное употребление понятий или выдумывание им новых, ранее не употреблявшихся, значений неминуемо ведет к путанице.
Так и не сводится. В живом языке термин имеет спектр значений в соответствии с употреблением. Это видно как по толковым словарям, так и особенно по межязыковым, поскольку в разных языках спектры значений часто не совпадают. В тех и других одному термину может соответствовать несколько (иногда даже десятки или очень редко сотни) объяснений/вариантов перевода.


Цитировать
Кто из нас, я извиняюсь, грек?
Хорошо. Тем более, что в греческом, как и в русском слово слишком многозначно.


Но вот в латыни, на базе которой создавалась современная наука, для "цели" несколько разных терминов. Основной термин - finis, близкий по широкому спектру значений греческому τέλος. А субъектность предполагает вариант intentio (англ. аналог intention, что обычно переводится на русский как намерение, хотя это и не совсем точно). Тогда давайте уточним, что Вы говорите о такой цели.
Тогда как мы говорим не об интенции, а скорее о propositum (англ. purpose).
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 12.09.2020, 15:20:46
что вам непонятно, знак в генетическом коде кадони условное соглашение обозначающие смысловую единицу генетического кода.
С чего вы решили, что кодон это знак? Может быть, вы не разобрались, что такое знак?
Знак это соглашение (явное или неявное) о приписывании чему-либо какого-либо определённого смысла, значения. Понимаете?

Кодон мог бы быть условным знаком, если бы мы с вами договорились, что увидя определенный кодон, вы подставляете определенную аминокислоту. А в случае ДНК, никаких условных знаков я не вижу. Происходят реакции в полном соответствии с законами химии. Все. 

Грубо говоря, вам нужно доказать, что результаты работы ДНК обусловлены специфическим "кодом", а не естественными patterns, которые свойственны всем химическим соединениям.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 12.09.2020, 15:24:30
А в случае ДНК, никаких условных знаков я не вижу. Происходят реакции в полном соответствии с законами химии. Все. 
В случае с компутером тоже никаких условных знаков нет? Происходят ведь реакции в полном соответствии с законами физики.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 12.09.2020, 15:37:59
в обоих случаях мы не знаем автора текста, он был в далеком прошлом, знаем что автор не был белкой. с высокой долей вероятности мы можем говорить что это был человек.
Мы знаем, что это был человек, этого нам вполне достаточно. Мы знаем это потому что остались многочисленные следы жизнедеятельности людей в том числе в том месте и в то время, куда относится и найденная береста.

А вот никаких следов агентов способных создать жизнь мы не наблюдаем, хотя способны различить присутствие бактерий в породе возрастом 3,5 млр лет.

Цитировать
Слово в генетическом языке это триплет кодон кодирующий однозначно одну аминокислоту или знак препинания.
Триплет кодон ничего не обозначает. Кодон это комбинация нуклеотидов, которая вступает в реакции с другими веществами строго по законам химии.
 
Цитировать
природа функционирует по правилам заданным ей из вне.
Голословно.

Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 12.09.2020, 15:59:06
Поэтому я и уточнил. Так оно и оказалось: смысл, который вкладываете в "цель" Вы, как минимум уже, а как максимум - вообще не пересекается с научным и философским пониманием, которым стараемся следовать мы с Александром.
У вас трудности с пониманием простых текстов? Почему вы продолжаете называть свой вариант определения научным и философским, если:
 - значение слова "цель" в абсолютном большинстве научных дисциплин то самое словарное, подразумевающее субъекта.
 - и в философском словаре первым идет такое же определение, а потом уже где-то там в статье говорится о взглядах Аристотеля и иже с ним.
Цитировать
Тогда надо конкретизировать, в каких дисциплинах, а также уточнить понятие субъекта.
Конечно, если вы берете какой-то специальное, редко употребляемое значение понятия, вам безусловно нужно было конкретизировать, что вы имеете ввиду.
Цитировать
Так и не сводится. В живом языке термин имеет спектр значений в соответствии с употреблением. Это видно как по толковым словарям, так и особенно по межязыковым, поскольку в разных языках спектры значений часто не совпадают. В тех и других одному термину может соответствовать несколько (иногда даже десятки или очень редко сотни) объяснений/вариантов перевода.
Вы не знаете, что значение это и есть определение? Не? :)
Цитировать
Хорошо. Тем более, что в греческом, как и в русском слово слишком многозначно.
Но вот в латыни, на базе которой создавалась современная наука, для "цели" несколько разных терминов. Основной термин - finis, близкий по широкому спектру значений греческому τέλος. А субъектность предполагает вариант intentio (англ. аналог intention, что обычно переводится на русский как намерение, хотя это и не совсем точно). Тогда давайте уточним, что Вы говорите о такой цели.
Тогда как мы говорим не об интенции, а скорее о propositum (англ. purpose).
Греков не нашли, начали искать римлян. Зачем?

Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 12.09.2020, 16:17:21
В случае с компутером тоже никаких условных знаков нет? Происходят ведь реакции в полном соответствии с законами физики.
В случае с жестким диском я могу показать те самые условные знаки, это намагниченные углубления на нем.
Что в нуклеотиде выполняет функцию упомянутых углублений на диске и как это может быть увидено в нуклеотиде?

Диск с информацией отличается от диска без информации наличием на нём последовательности углублений. Таким образом я знаю, что некая информация на диске с углублениями, в отличии от диска без углублений, есть.
Я знаю кто эти углубления нанёс и каким образом это было сделано.
Я также понимаю механизм посредством которого информация, закодированная последовательностью углублений, в конечном предстанет передо мной в готовой к восприятию форме.

Ничего подобного о нуклеотидах я сказать не могу.
Я просто не вижу в них никакой информации.
Я даже не вижу, каким образом можно фальсифицировать ваше утверждение о наличии в нуклеотидах информации, или, по простому, как отличить нуклеотид с информацией от нуклеотида без информации. На диске я это сделать могу, а в нуклеотиде нет.
Естесвенно, что я совершенно очевидно не могу ни видеть, ни знать, ни даже представить себе кто и каким образом эту неотличимую от несуществующей "информацию"
мог в нуклеотид занести и каков должен быть механизм трансформирования "закодированной" "информации" в готовый к восприятию информационный продукт.

Всё, что я вижу, это набор химических эллементов, называемый нуклеотид, который ведёт себя точно также как и любой другой набор химических эллементов, а имено
без посторонней помощи, только согласно законам физики и химии, которым подчиняются все известные нам наборы химических эллементов, вступает в химические реакции с другими наборами химических эллементов что приводит к результатами обусловленными законами физики и химии.

Ленчик
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 12.09.2020, 16:28:45
В случае с компутером тоже никаких условных знаков нет? Происходят ведь реакции в полном соответствии с законами физики.
Условность означает, что соответствие между знаком и его интерпретацией условное. Например, в азбуке Морзе код "...-" обозначает латинский символ V и русский символ Ж. Поэтому для доказательства условности ДНК вам надо показать, что есть сторонний интерпретатор ДНК.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 12.09.2020, 17:01:06
Вы не знаете, что значение это и есть определение? Не? :)
Ни в коем случае. Значение (а в живом языке как правило спектр значений) существует и при отсутствии определения.

Цитировать
Греков не нашли, начали искать римлян. Зачем?
Если не нравятся греки с их философией, то я подумал, что может быть Вас устроит язык, на котором закладывали основы европейской науки. Но раз Вам милее и критерий истинности бытовое словоупотребление, то откланиваюсь. Всего доброго.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 12.09.2020, 17:16:05
Условность означает, что соответствие между знаком и его интерпретацией условное. Например, в азбуке Морзе код "...-" обозначает латинский символ V и русский символ Ж. Поэтому для доказательства условности ДНК вам надо показать, что есть сторонний интерпретатор ДНК.
Маленькое уточнение: не нам надо показать, а наличие кодировки уже показывает, что есть такой интерпретатор.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 12.09.2020, 19:21:19
Ни в коем случае. Значение (а в живом языке как правило спектр значений) существует и при отсутствии определения.
Хорошо, оставим термин "определение". Можете заменить его у меня в постах на "значение". Будете спорить, что смысл слова не сводится к значению? Будете спорить, что правильное значение слов дают не словари?

Цитировать
Если не нравятся греки с их философией, то я подумал, что может быть Вас устроит язык, на котором закладывали основы европейской науки.
Мы, если не заметили общаемся по русски. Очень наивно думать, что если вы не можете доказать свой тезис на родном языке у вас это выйдет по латыни.

Цитировать
Но раз Вам милее и критерий истинности бытовое словоупотребление, то откланиваюсь. Всего доброго.
Очевидно, вы не страдаете интеллектуальной честностью. Как вы можете такое говорить, если:
- значение слова "цель" в абсолютном большинстве научных дисциплин то самое словарное, подразумевающее субъекта.
- и в философском словаре первым идет такое же определение, а потом уже где-то там в статье говорится о взглядах Аристотеля и иже с ним.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 12.09.2020, 19:23:49
Маленькое уточнение: не нам надо показать, а наличие кодировки уже показывает, что есть такой интерпретатор.
Угу. Только пока ни вы, ни ваши коллеги не могут показать эту самую кодировку (систему условных обозначений) в ДНК. :)
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 12.09.2020, 20:31:46
Хорошо, оставим термин "определение". Можете заменить его у меня в постах на "значение". Будете спорить, что смысл слова не сводится к значению? Будете спорить, что правильное значение слов дают не словари?
С Вами и Вашей софистикой я уже не буду спорить.

Особенно после этого:

Угу. Только пока ни вы, ни ваши коллеги не могут показать эту самую кодировку (систему условных обозначений) в ДНК. :)



Александр её Вам здесь привёл, но некоторые "глазами смотрят и не видят" (с). 
Поэтому метать бисер нет никакого смысла.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 12.09.2020, 21:30:34
Поэтому метать бисер нет никакого смысла.
О! Вы неправильно понимаете "метание бисера перед свиньями". Бисер - это уже тонкости, детали, а вы реальность кодировки через ДНК не предъявили даже грубо и приближённо. Впрочем, чего со свиньями церемониться.  :'(
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 12.09.2020, 23:30:36
Условность означает, что соответствие между знаком и его интерпретацией условное. Например, в азбуке Морзе код "...-" обозначает латинский символ V и русский символ Ж. Поэтому для доказательства условности ДНК вам надо показать, что есть сторонний интерпретатор ДНК.
Допустим создан супертехнологический комплекс полного замкнутого цикла. где участие стороннего интерпретатора написание программы загрузка её в суперкомпьютер и запуск процесса. добыча полезных ископаемых их переработка и всё до выхода готовой продукции роботизировано и автоматизировано как в клетке. суперпрограмма такова что в ней заложено полное воспроизводство всей замкнутой технологической цепочки, такие производственные комплексы сами себя воспроизводят, и создают всё многообразие мира вещей. человек тут уже не нужен, кроме как вносить изменения в программе. допустим на какой то планете человечество вымерло, а система работает сама по себе. и что если человечество вымерло, у этой системы не было разумного архитектора?
(https://cf.ppt-online.org/files/slide/0/0kDSbjyWXi2ma7FQ9RtzusdJU85Oqgw3ETIGAM/slide-5.jpg)
В генетическом коде используется слово однозначное соответствие кодона определенной аминокислоте. Один и тотоже кодон не может кодировать две или более аминокислоты. вырожденность нам говорит что одна аминокислота может кодироваться несколькими кодонами, но только один кодон кодирует одну аминокислоту.
(https://mypresentation.ru/documents/7097c7326fbab6f155969546ced5fbe1/img26.jpg)

(https://ds03.infourok.ru/uploads/ex/0b27/0001f36e-d5bcaa28/img8.jpg)
     
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 13.09.2020, 00:14:51
Угу. Только пока ни вы, ни ваши коллеги не могут показать эту самую кодировку (систему условных обозначений) в ДНК. :)
(https://ds04.infourok.ru/uploads/ex/062c/00148c13-d96a6a97/hello_html_487214ce.jpg)
вот вам топографические условные обозначения.
(https://ds03.infourok.ru/uploads/ex/1191/000247f8-1e0cf07d/img17.jpg) может это подойдёт электрическая схема цепей отражает то, что реально расположено на плате.
(https://s1.slide-share.ru/s_slide/6ee578fd81738e3a5590c50153e66d8a/adafee00-b2de-40f2-8270-279f2600d12b.jpeg)
вот вам условное обозначение триплетов кодонов

(http://900igr.net/up/datas/249423/068.jpg)

(https://cf.ppt-online.org/files/slide/9/9Y4Ok5nBRaCNhL8VIcKvXq6lHM1AwTpUGxjboS/slide-7.jpg)

(https://cloud.prezentacii.org/19/03/132872/images/screen10.jpg)
ну вот вам условные обозначения подобно топографическим, которые обусловили люди для удобства прочтения кода. все условные обозначения мы сами создаём для удобства понимания вещей природных.   
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 13.09.2020, 00:25:41
О! Вы неправильно понимаете "метание бисера перед свиньями". Бисер - это уже тонкости, детали, а вы реальность кодировки через ДНК не предъявили даже грубо и приближённо. Впрочем, чего со свиньями церемониться.  :'(
Что означает это реальность кодировки через ДНК? вы можете мне представить реальность программного кода через жесткий диск носителя(винчестер) ну вот он даже вскрыт, ну как там с реальностью кодировки через жесткий диск?
(https://d3fa68hw0m2vcc.cloudfront.net/265/230471895.jpeg)
ну вы там что то видите, где? мне что то не видно, подождите очки возьму. 
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 13.09.2020, 08:11:46
О! Вы неправильно понимаете "метание бисера перед свиньями". Бисер - это уже тонкости, детали, а вы реальность кодировки через ДНК не предъявили даже грубо и приближённо.
По контексту это не тонкости и детали, а знание, неприемлемое для того, к кому обращаются.

Цитировать
Впрочем, чего со свиньями церемониться.  :'(
Вы сказали. Надеюсь Модест Матвеевич не поймёт буквально, а то он всё словарями руководствуется.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 13.09.2020, 10:32:07
Александр её Вам здесь привёл, но некоторые "глазами смотрят и не видят" (с). 
Поэтому метать бисер нет никакого смысла.
Опять пишите неправду, поздравляю вас, гражданин.
Александр52 ничего не привел и судя по его постам понять не может, что его просят привести. Хотя не исключено, что он тоже жульничает пытаясь заменить одно другим.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 13.09.2020, 10:44:13
вот вам топографические условные обозначения.
может это подойдёт электрическая схема цепей отражает то, что реально расположено на плате.
вот вам условное обозначение триплетов кодонов
Не подойдет. Если конечно, вы не собираетесь доказывать, что электрические цепи это язык или код со своим алфавитом и пр.

Еще раз. Если вы утверждаете, что ДНК это код (система условных знаков), то должны показать эти условные знаки именно в ДНК. Таблицы на картинках из учебника естественно не в счёт, поскольку они демонстрируют не "условные обозначения", якобы существующий непосредственно в ДНК, а созданные учёными вспомогательные описания естественных конфигураций, наблюдаемых в ДНК.

Цитировать
ну вот вам условные обозначения подобно топографическим, которые обусловили люди для удобства прочтения кода. все условные обозначения мы сами создаём для удобства понимания вещей природных.
То есть, условных обозначений непосредственно в ДНК нет? Мы их создали сами для себя для удобства понимания? Браво!
Теперь вы понимаете, что сама по себе ДНК ни кодом, ни языком не является и как следствие не нуждается в программисте.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 13.09.2020, 17:02:30
По контексту это не тонкости и детали, а знание, неприемлемое для того, к кому обращаются.
Вы сказали. Надеюсь Модест Матвеевич не поймёт буквально, а то он всё словарями руководствуется.
не мечите бисер пред троллем. У него нет аргументов. Свинья это не политкорректно.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 13.09.2020, 18:33:30
не мечите бисер пред троллем. У него нет аргументов.
Да, я заметил, что он троллит, поэтому перестал отвечать. Да и Михай Вадимович недалеко ушёл, хотя в одной из прежних тем мне показалось, что он действительно хотел разобраться.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 13.09.2020, 19:53:14
Существуют ли научные разработки таких критериев? Кто-то в учёном сообществе этим занимался?

Прошу не брать в рассмотрение "не уменьшаемую сложность систем", так как это частный случай для некоторых узких био-систем и не работает как универсальный критерий для других объектов.
Может быть, сам вопрос неправильно поставлен?

Мир сотворен Богом. Человек может что-либо творить как раз потому, что он сам сотворен по образу и подобию Творца. Поэтому, если мы называем "искусственным" то, что сделано человеком, то точно так же надо назвать вообще все существующее - ведь оно сделано Богом.

С другой стороны, Бог творит не хаотично, взмахами волшебной палочки, как Незнайка в Солнечном городе, а упорядоченно, согласно установленным Им законам природы. Иными словами, все, что делает Бог, соответствует законам природы. Следовательно, все творение - естественно. Но точно так же и человек творит свои изделия в согласии с законами природы. Процесс изготовления автомобиля так же естественен, как и процесс размножения кроликов.

Может быть, вообще нет никакого различия между "естественностью" и "искусственностью", а есть различие в масштабах? Богу не нужны ни руки, ни механизмы, чтобы творить мир - Он творит словом. Человек, в принципе, тоже творит словом, особенно писатели, но обычно ему нужно множество вспомогательных инструментов, от ручки и бумаги до сборочного цеха.

Человек, конечно, ближе к Богу по масштабу, чем бобры, соответственно, в его творениях больше человеческого и меньше природного, чем в хатках бобров. Но можно представить себе формы жизни, еще более близкие к Богу. Для такого "человека" достаточно сказать слово, и планета сдвинется со своей орбиты в нужную сторону - разумеется, при полном соблюдении законов природы (произойдет что-нибудь, способное изменить орбиту). А на еще более высоком уровне масштаба "человек" сможет влиять на основополагающие законы мироздания. И тогда все его "искусственные" творения будут получаться исключительно естественным образом - согласно тем самым законам природы, которые он же и сформулировал.

Если учесть весь этот спектр возможностей, остается только одно, пусть очень частное, но корректное определение искусственности: сделано человеком. Конкретно человеком, а не бобром, не андромедянином и не Богом.
Название: Re: Критерии искусственности объекта.
Отправлено: Лаврентьевич от 13.09.2020, 19:53:58
Не подойдет. Если конечно, вы не собираетесь доказывать, что электрические цепи это язык или код со своим алфавитом и пр.

Еще раз. Если вы утверждаете, что ДНК это код (система условных знаков), то должны показать эти условные знаки именно в ДНК. Таблицы на картинках из учебника естественно не в счёт, поскольку они демонстрируют не "условные обозначения", якобы существующий непосредственно в ДНК, а созданные учёными вспомогательные описания естественных конфигураций, наблюдаемых в ДНК.
То есть, условных обозначений непосредственно в ДНК нет? Мы их создали сами для себя для удобства понимания? Браво!
Теперь вы понимаете, что сама по себе ДНК ни кодом, ни языком не является и как следствие не нуждается в программисте.
Модест, вы меня разочаровали.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 13.09.2020, 20:17:23
Да, я заметил, что он троллит, поэтому перестал отвечать. Да и Михай Вадимович недалеко ушёл, хотя в одной из прежних тем мне показалось, что он действительно хотел разобраться.
Владимир Витальевич и Александр_52 не троллят в данном случае, и это печально, потому что свидетельствует о непонимании. Я иногда троллю, но не в этом случае. Модест, по-моему, никогда не троллит. Я предложил предъявить стороннего интерпретатора, который соотносит с условными знаками некоторое содержание, вполне серьёзно. Какие такие основания у вас обвинять меня в троллинге? Подумайте об этом.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 13.09.2020, 23:43:22
Владимир Витальевич и Александр_52 не троллят в данном случае, и это печально, потому что свидетельствует о непонимании. Я иногда троллю, но не в этом случае. Модест, по-моему, никогда не троллит. Я предложил предъявить стороннего интерпретатора, который соотносит с условными знаками некоторое содержание, вполне серьёзно. Какие такие основания у вас обвинять меня в троллинге? Подумайте об этом.
(http://propionix.ru/thumb/2/MiEjZzFNO3HkWtMEya47Qg/r/d/transkriptsiya.png)
Рис. Схематическое изображение транскрипции
Транскрипция – это процесс синтеза РНК на матрице ДНК. ДНК раскручивается на одном из участков. На одной из цепей содержится информация, которую необходимо скопировать на молекулу РНК – эта цепь называется кодирующей. Вторая цепь ДНК, комплементарная кодирующей, называется матричной. В процессе транскрипции на матричной цепи в направлении 3’ – 5’ (по цепи ДНК) синтезируется комплементарная ей цепь РНК. Таким образом, создается РНК-копия кодирующей цепи.

Например, если нам дана последовательность кодирующей цепи

3’– ATGTCCTAGCTGCTCG – 5’,

то, по правилу комплементарности, матричная цепь будет нести последовательность

5’– TACAGGATCGACGAGC– 3’,

а синтезируемая с нее РНК – последовательность

3’– AUGUCCUAGCUGCUCG – 5’.

(http://propionix.ru/thumb/2/HCN-IzoKD7P_GyleAn92pQ/r/d/sintez_belka.png)
Рис. Процесс синтеза белка: ДНК кодирует РНК, РНК кодирует белок.
на закодированной мРНК закодирована последовательность триплетов. Допустим это условные знаки кода, которых нужно интерпретировать, то есть прочитать, проанализировать и определить соответствующие действия. для этих целей есть рибосома, на которой идет синтез белка, куда транспортные тРНК доставляют аминокислоты. этот процесс автоматический. 

Пример. Нам дана последовательность кодирующей цепи:

3’– CCGATTGCACGTCGATCGTATA– 5’.

Матричная цепь будет иметь последовательность:

5’– GGCTAACGTGCAGCTAGCATAT– 3’.

Теперь «синтезируем» с этой цепи информационную РНК:

3’– CCGAUUGCACGUCGAUCGUAUA– 5’.

Синтез белка идет в направлении 5’ → 3’, следовательно, нам нужно перевернуть последовательность, чтобы «прочитать» генетический код:

5’– AUAUGCUAGCUGCACGUUAGCC– 3’.

Теперь найдем старт-кодон AUG:
5’– AUAUGCUAGCUGCACGUUAGCC– 3’.
Найдем стоп-кодон UAG и согласно таблице генетического кода запишем последовательность аминокислот:
5’– AUAUGCUAGCUGCACGUUAGCC– 3’

(http://propionix.ru/thumb/2/rCGr0-fPu-slUKmtZVTefA/r/d/7_4.jpg)

(http://propionix.ru/thumb/2/g3J79YjibniEhj4cDOhBNQ/r/d/tsentralnaya_dogma_molekulyarnoy_biologii.png)
Центральная догма молекулярной биологии звучит следующим образом: информация с ДНК передается на РНК (транскрипция), с РНК – на белок (трансляция). ДНК также может удваиваться путем репликации, и также возможен процесс обратной транскрипции, когда по матрице РНК синтезируется ДНК, но такой процесс в основном характерен для вирусов.



(http://propionix.ru/thumb/2/29S8Ue6c3YSFFehazJIX6g/r/d/bezymyannyy3.jpg)
Рис. Соответствие между кодирующими участками ДНК, мРНК и аминокислотной последовательностью полипептидной цепи.

Современное биохимическое определение гена. Генами называются все участки ДНК, кодирующие первичную последовательность конечных продуктов, к которым относятся полипептиды или РНК, обладающие структурной или каталитической функцией.

 
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 14.09.2020, 04:05:20
Видите ли, информация, программа, алфавит, язык/код по отношению к ДНК это всего лишь аналогии для понимания суперсложных последовательностей и закономерностей химических реакций.
А почему использована именно эта аналогия? Потому, что наиболее подходяще описывает происходящее?

Программа в ДНК это последовательность реакций обусловленная химическими свойствами молекулы. Ни к каким языкам программирования, в смысле системы условных обозначений, это отношения не имеет. По крайней мере пока эти условные обозначения не будут в ДНК представленны.
Последовательность дырок на перфоленте - это условность, и вы с этим согласились. Тогда почему же, аналогичная последовательность нуклеотидов не условность?

Тоже самое код, имеется в виду не система условных обозначений, а в значении ,pattern то есть повторяющиеся и предсказуемые естественные конфигурации. 
А соответственно, и программист нам без надобности. Потому, что это прямо логически вытекает из ваших попыток поймать науку на слове. Потому, что в плане кода, как системы условных обозначение, ДНК ничем не отличается от любой другой молекулы.
  "pattern, то есть повторяющиеся и предсказуемые естественные конфигурации."  -- так для вас "условность" - это не свойства самого кода, а источник его происхождения, т.е. то, чего в самом коде нет?

И каким образом информация в генах предсказуема, если её надо расшифровывать? 

С чего вы решили, что программист не нужен, если в последовательности нуклеотидов надо зашифровать параметры ваших ушей? Как это сделать без программиста? Нужен разумный агент, который параметры ушей будет абстрактно переносить на то, что с ушами ни как не связано и даже с ними ни как не соприкасалось.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 14.09.2020, 04:13:37
Тоже, что и все:
Знак — соглашение (явное или неявное) о приписывании чему-либо какого-либо определённого смысла, значения.
Так гены несут значения вашего организма?

Условно нет, по крайней мере, пока вы эту условность мне не покажете.
Последовательность дырок на ленте, кодирующие параметры ваших ушей, для изготовления их на станке ЧПУ это условность. А последовательность нуклеотидов, кодирующие те же параметры ваших ушей для изготовления их на голове, по вашему, это не условность. Почему? 
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 14.09.2020, 04:39:23
Да? А с чего вы решили?
Да, у электронов есть такое свойство ну и что. На каком основании, вы это свойство объявляете целью?
Потому, что эти свойства неумолимо стремятся к полезному результату - создание вселенной. Вот если результат бесполезен, тогда и цели нет.

Вот, у человека есть свойство, например, потеть. Выделение пота является целью человека?
У пота оказывается есть цель - охлаждать организм.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 14.09.2020, 09:55:48
Рис. Схематическое изображение транскрипции
Вы описали генетические механизмы. В любом механизме что-то делается - крутятся шестерни, ходят поршни, переключаются реле. Условность знака означает, что содержание ему придаёт интерпретатор. Например,  в азбуке Морзе код "...-" обозначает латинский символ V и русский символ Ж. Генетический механизм реализует свою функцию в силу своего собственного устройства, подобно тому, как работает червячная передача, например.  Поэтому и о "генетическом коде" можно говорить только условно. Так я понимаю этот вопрос.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 14.09.2020, 10:30:03
Вы описали генетические механизмы. В любом механизме что-то делается - крутятся шестерни, ходят поршни, переключаются реле. Условность знака означает, что содержание ему придаёт интерпретатор. Например,  в азбуке Морзе код "...-" обозначает латинский символ V и русский символ Ж. Генетический механизм реализует свою функцию в силу своего собственного устройства, подобно тому, как работает червячная передача, например.  Поэтому и о "генетическом коде" можно говорить только условно. Так я понимаю этот вопрос.
Условность знака в том, что он передаёт информацию о стороннем объекте, который никак не связан с этим знаком.. В этом отличие от механизма от червячной передаче, который информацию не передаёт о ухе водителя, например. А код ДНК такую информацию передаёт.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 14.09.2020, 11:01:25
Условность знака в том, что он передаёт информацию о стороннем объекте, который никак не связан с этим знаком.. В этом отличие от механизма от червячной передаче, который информацию не передаёт о ухе водителя, например. А код ДНК такую информацию передаёт.
Знак сам по себе ничего не передаёт, на то он и знак.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 14.09.2020, 12:50:44
Знак сам по себе ничего не передаёт, на то он и знак.
последовательность знаков передаёт
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 14.09.2020, 14:28:12
последовательность знаков передаёт
Тоже нет.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 14.09.2020, 14:43:53
Знак сам по себе ничего не передаёт, на то он и знак.
Знак - я предпочитаю термин "символ" - передает информацию. И совершенно неважно, что это - кодон в ДНК или углубление в диске. Также неважно, сделан этот символ человеком или нет. В любом случае он передает информацию, совершенно объективную сущность, которую можно измерить в килобайтах, закодировать разными способами, даже сжать архиватором.

Важно, что символ принципиально отличен от того объекта, который он описывает. Так, вода не является символом льда. Вода замерзает, получается лед, но по сути это одно и то же вещество, просто в разных состояниях. Трава не является символом росы, хотя на траве утром появляется роса. В самой траве нет ничего, что символизировало бы росу, и роса с тем же успехом появится утром на любом предмете. И даже белковая молекула не является ничьим символом.

В отличие от этого, написанное слово "Петр" качественно отличается от человека по имени Петр, причем по всем параметрам. У этих 4 букв нет ничего общего с человеком. Произнесенное вслух слово "обезьяна" - это некий набор акустических волн, которые опять-таки принципиально отличны от самой обезьяны. Программа, управляющая 3D-принтером, который "печатает" кусок мяса - нечто качественно отличное от самого куска мяса. Все это символы (или последовательности символов, что в принципе то же самое).

Аналогично, молекула ДНК - это нечто качественно иное, чем белки, которые синтезируются на ее основе. Если просто навалить в кучу множество молекул ДНК, то никакой реакцией вы из них белок не получите. Чтобы получился белок, запускается сложный механизм трансляции через РНК, очень похожий на компьютеры, которые разработаны человеком, только гораздо компактнее. Кодоны ДНК - символы аминокислот, так же как и углубления на диске - символы персонажей видеоигры. Более того, каким-то образом получается, что ДНК является также символом биологического вида в целом со всеми его особенностями.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 14.09.2020, 17:27:42
Знак - я предпочитаю термин "символ" - передает информацию.
Нет, знак не передатчик. Информация передаётся посредством знаков.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 14.09.2020, 19:21:57
А почему использована именно эта аналогия? Потому, что наиболее подходяще описывает происходящее?
Именно так.

Цитировать
Последовательность дырок на перфоленте - это условность, и вы с этим согласились. Тогда почему же, аналогичная последовательность нуклеотидов не условность?
Наличие или отсутствие дырок на перфоленте это условный знак. Он определенным образом нанесен на перфоленту, перфолента с информацией отличается от перфоленты без информации. Я знаю кто и как нанес эти условные знаки.

Про последовательность нуклеотидов невозможно сказать, что она аналогичная. Чем она аналогична перфоленте? Нуклеотид это химическое соединение, которое реагирует с другими соединениями строго по законам химии.

Вам нужно показать, что что результаты работы ДНК обусловлены специфическим "кодом", а не естественными patterns, которые свойственны всем химическим соединениям.
 
Цитировать
"pattern, то есть повторяющиеся и предсказуемые естественные конфигурации."  -- так для вас "условность" - это не свойства самого кода, а источник его происхождения, т.е. то, чего в самом коде нет?
Условность это некая договоренность. Вот мы договорились, что дырка в перфоленте это 0, а отсутствие дырки 1, соответственно на это настроена машина, читающая перфоленту. Договорились о значении слов в языке. Поэтому и дырка в перфоленте и слово это условный знак.
А в ДНК никаких договоренностей нет, одна химия.
Цитировать
И каким образом информация в генах предсказуема, если её надо расшифровывать? 
А что вы имеете ввиду под "информация в генах предсказуема"? 
Есть прямая зависимость между геномом и строением организма, его свойствами  и тд. Зная это зависимость можно будет по геному делать справедливые выводы об организме в целом. Но, до полного понимания, тут еще очень и очень далеко.
Цитировать
С чего вы решили, что программист не нужен, если в последовательности нуклеотидов надо зашифровать параметры ваших ушей? Как это сделать без программиста? Нужен разумный агент, который параметры ушей будет абстрактно переносить на то, что с ушами ни как не связано и даже с ними ни как не соприкасалось.
Не нужен. Новые функциональные гены возникают сами, без всякого программиста.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 14.09.2020, 19:30:58
Так гены несут значения вашего организма?
Конечно несут. Только тут ни при чем, ни языки, ни семантика вообще.
А раз нет семантики, то и автор не нужен.
Цитировать
Последовательность дырок на ленте, кодирующие параметры ваших ушей, для изготовления их на станке ЧПУ это условность. А последовательность нуклеотидов, кодирующие те же параметры ваших ушей для изготовления их на голове, по вашему, это не условность. Почему?
Уже объяснил. Отсутствуют условные знаки. Нету никаких абстрактных правил (договоренностей).
Конечно можно, таковыми правилами считать всю химию, но тогда получится, что любая молекула это код.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 14.09.2020, 19:31:03
Нет, знак не передатчик. Информация передаётся посредством знаков.
Оксюморон. То, посредством чего передается что-то, и есть передатчик. Радиопередатчик - то, что передает радиосигналы.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 14.09.2020, 20:13:52
Потому, что эти свойства неумолимо стремятся к полезному результату - создание вселенной. Вот если результат бесполезен, тогда и цели нет.
И какая электронам с этого польза? :)
Цитировать
У пота оказывается есть цель - охлаждать организм.
При чем тут пот, не нужно соскакивать. Мы говорили про цель человека. У человека есть свойство потеть. Полезное это свойство? Еще какое.
Если задать вопрос о цели человеческого потоотделения любой базарной мухе (при условии, что таковая умела бы говорить), она не задумываясь ответила бы, что смысл потоотделения  в том, что бы она, муха это ела. Более того, охлаждение организма это дополнительный положительный эффект, который позволяет человеку и дальше успешно выполнять свою главную целевую функцию - производить пот и еще кое-что, чем эта муха питается.

Лично я, и в ваших рассуждениях и в рассуждениях мухи, вижу одну и ту же ошибку. Очень наивно, не имея никаких тому доказательств, считать себя центром мироздания.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 14.09.2020, 21:41:53
Оксюморон. То, посредством чего передается что-то, и есть передатчик. Радиопередатчик - то, что передает радиосигналы.
Нет. То, посредством чего передается что-то, не обязательно есть передатчик.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 14.09.2020, 21:42:35
Нет, знак не передатчик. Информация передаётся посредством знаков.
(https://cf.ppt-online.org/files/slide/w/wubiPEVlWeSU8TZd7LICanXmzHc6fgyNhM5DAY/slide-53.jpg) транспортная РНК. на 3’-конце всех тДНК находится аденин

(http://propionix.ru/thumb/2/dHBQp_9OpYiPjqWb630Zyg/680r/d/azotistyye_pirimidinovyye_i_purinovyye_osnovaniya.jpg)
(http://images.myshared.ru/4/97080/slide_93.jpg)

Для каждой из 20 аминокислот в клетках есть специальный фермент, осуществляющий синтез соответствующей аминоацил тРНК (общее название – аминоацил-тРНК-синтетазы, для краткости будем называть их синтетазами). Все ферменты этой группы катализируют реакции аминоацилирования тРНК по принципиально сходному механизму. Реакция сопряжена с расщеплением аденозин-5'-трифосфата (ATP) или по русски АТФ  и протекает в две стадии. На первой стадии происходит активация аминокислоты с использованием энергии, запасенной в ATP, а на второй активированный аминоацильный остаток аденозин-5'-монофосфата АМФ в составе аминоацил-аденозин-5'-монофосфата аминоацил-АМФ  переносится на одну из гидроксильных групп рибозного кольца концевого аденозина на CCA-конце тРНК, здесь Р = Ф, английская и русская буквы означающие остаток фосфорной кислоты или фосфат. Аминокислота прикрепляется к тРНК с отделением АМФ.


(https://sun9-30.userapi.com/TrkVkmnf3I7J4-EfUuElG5fRlM8524rGBN-Vlg/_VvYqZorXBY.jpg)
Например, глицин-тРНК-синтетаза катализирует суммарную реакцию синтеза глицин-тРНК:
Gly + тРНК + ATP <-> Gly-тРНК + AMP + PP, (1)
включающую следующие две стадии:
E + Gly + ATP <->  E*(Gly-AMP) + PP, (2)
E*(Gly-AMP) + тРНК <->  E + AMP + Gly-тРНК, (3)
где E – фермент, Gly – глицин, ATP и AMP – аденозин-5'- три- и монофосфат соответственно, PP – пирофосфат, E*(Gly-AMP) – комплекс фермента с аминоациладенилатом, тРНК – специфическая глициновая тРНК, Gly-тРНК – глицин-тРНК.

Как видно из уравнения (2), образующийся на первой стадии реакции аминоациладенилат Gly AMP, в котором остаток глицина активирован за счет гидролиза макроэргической связи ATP и отщепления пирофосфата PP, не покидает молекулы глицин тРНК-синтетазы, образуя с ней комплекс. Происходящий затем перенос аминоацильного остатка из Gly-AMP на глициновую тРНК (уравнение (3))  завершает реакцию аминоацилирования тРНК и приводит к освобождению фермента и AMP. Исключительно низкая частота ошибок при аминоацилировании тРНК (<10−4) является непременным условием реализации генетического кода. Дело в том, что при биосинтезе белков в рибосомах выбор аминокислоты, включающейся в растущую белковую цепь, зависит исключительно от адапторной молекулы тРНК, к которой она прикреплена. Если на предрибосомном этапе произошла ошибка и к тРНК присоединилась аминокислота, не соответствующая специфичности антикодона, то эта ошибка уже не может быть исправлена на последующих этапах белкового синтеза. При этом не имеет значения, при отборе какого из субстратов реакции (1) – тРНК или аминокислоты – ошиблась соответствующая аминоацил-тРНК-синтетаза. В любом случае продукт реакции (аминоацил-тРНК) будет включать в синтезирующуюся в рибосоме молекулу белка аминокислотный остаток, не соответствующий кодирующему триплету мРНК. Неудивительно, что в ходе эволюции выработались специфические механизмы отбора “правильных” субстратов для аминоацил-тРНК-синтетаз, обеспечивающие безошибочное аминоацилирование тРНК. В связи с особым значением этих механизмов для реализации генетической информации их называют иногда вторым генетическим кодом. Аденин на конце у всех без исключения тРНК, как то знает фермент что там в зоне петли антикодона находится. 
(https://cf.ppt-online.org/files/slide/0/0ZjAWcvFrX2sxeadRQzDiqPnp4ykL6Tg9E1CB7/slide-15.jpg)
(https://studydocs.ru/studfiles/41/916/615700/Биология%20в%202кн_кн1_Ярыгин%20Васильева%20и%20др_Учебник_2003%20-432с.doc_html_1bb716551d98b713.png)

вот еще одна хорошая наглядная схема. каждому из 61 кодирующего кодона есть свой специфический фермент, который строго соответствует коду антикодона. вот где технологическая премудрость Божия.
(https://studfile.net/html/2706/997/html_qrBrf2B1qK.NkxZ/img-2eLjrv.png)

(https://cf2.ppt-online.org/files2/slide/v/VnkNtE9LMYj8FBGSfsewvruXhAUIxP2TWmz7p45Cg/slide-42.jpg)

И так что мы имеем? На полинуклеотидной цепи ДНК мы имеем гены, которые кодируют ферменты-белки, которые в третичной и четвертичной структуре сворачиваются пространственно так, что имеют три активные зоны, в которых может встроится (поместится) только одна строго конкретная аминокислота в одной активной зоне, в другую встроится строго определенная тРНК, а в третьей активной зоне строго заданная аминокислота присоединяется к аденину строго заданной тРНК с антикодоном, соответствующим кодируемой аминокислоте на мРНК. 
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 14.09.2020, 23:25:38
Конечно несут. Только тут ни при чем, ни языки, ни семантика вообще.
А раз нет семантики, то и автор не нужен.Уже объяснил. Отсутствуют условные знаки. Нету никаких абстрактных правил (договоренностей).
Конечно можно, таковыми правилами считать всю химию, но тогда получится, что любая молекула это код.
Сема́нтика (от др.-греч. σημαντικός «обозначающий») — раздел лингвистики, изучающий смысловое значение единиц языка.
словом яблоко я обозначаю этот предмет (https://beatingpancreatitis.com/wp-content/uploads/2014/06/apple.jpg) я произношу яблоко вы подразумеваете то что на картинке изображено. триплет-кодон UCC обозначает генетическое слово, однозначный смысл которого раскрывается в аминокислоте Серин. Семантика налицо.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 14.09.2020, 23:32:57
Нет. То, посредством чего передается что-то, не обязательно есть передатчик.
Может быть и есть такие примеры, не знаю. Во всяком случае символ - это безусловно передатчик информации. Или носитель.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 15.09.2020, 00:07:27
Может быть и есть такие примеры, не знаю. Во всяком случае символ - это безусловно передатчик информации. Или носитель.
передатчик матричная РНК, она транслирует или передает информацию на приемник рибосому, ка последней переданная через мРНК информация с ДНК становится объективной реальностью белка.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 15.09.2020, 02:58:50
передатчик матричная РНК, она транслирует или передает информацию на приемник рибосому, ка последней переданная через мРНК информация с ДНК становится объективной реальностью белка.
Я в курсе.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 15.09.2020, 06:27:45
Может быть и есть такие примеры, не знаю. Во всяком случае символ - это безусловно передатчик информации. Или носитель.
Господь с вами! Я сейчас в этом сообщении передаю информацию посредством знаков письменной речи, а в качестве передатчика использую интернет.
Знаков-передатчиков не бывает из-за семантической несочетаемости, разве что в поэтической стилистике.
Носитель  - да.

C вами почти всё время уходит на прояснение семантики простых слов и словосочетаний  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 15.09.2020, 15:58:57
Господь с вами! Я сейчас в этом сообщении передаю информацию посредством знаков письменной речи, а в качестве передатчика использую интернет.
Знаков-передатчиков не бывает из-за семантической несочетаемости, разве что в поэтической стилистике.
Носитель  - да.

C вами почти всё время уходит на прояснение семантики простых слов и словосочетаний  :)
Хорошо, согласен. Пусть будет носитель. Мне казалось, слово "передатчик" здесь тоже уместно, но словари на вашей стороне: это либо прибор для передачи информации, либо человек, передающий что-либо.

Таким образом, ДНК - носитель информации, а РНК, которые трансформируют ее в белок - передатчики. ДНК несет информацию, а РНК ее передает.
Название: Re: Критерии искусственности объекта.
Отправлено: Nikolai M. от 15.09.2020, 17:19:39
Меня вообще вот что удивляет - в науке постулат о генетической информации абсолютно мэнстрим. Огромное количество
статей, есть куча книг. Против этого понятия обычно были виталисты и структуралисты.
Зато тутошние атеисты ломают копья.
Абсурдная ситуация.

PS: С другой стороны они (форумные атеисты) более последовательны. В действительности, чтобы генетическая да и любая биологическая информация стала таковой нужен интерпретатор коим является организм, а для этого надо принять форму витализма. Или создать модифицированную теорию осмысливания информации.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 15.09.2020, 17:34:49
Таким образом, ДНК - носитель информации, а РНК, которые трансформируют ее в белок - передатчики. ДНК несет информацию, а РНК ее передает.
Это возражений не вызывает. А то здешние генетики всё говорят о каком-то коде ))
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 15.09.2020, 18:06:20
Меня вообще вот что удивляет - в науке постулат о генетической информации абсолютно мэнстрим. Огромное количество
статей, есть куча книг. Против этого понятия обычно были виталисты и структуралисты.
Зато тутошние атеисты ломают копья.
Абсурдная ситуация.

PS: С другой стороны они (форумные атеисты) более последовательны. В действительности, чтобы генетическая да и любая биологическая информация стала таковой нужен интерпретатор коим является организм, а для этого надо принять форму витализма. Или создать модифицированную теорию осмысливания информации.
код это плод разума. Бога нет, а во времена формирования клетки никакого разума не было, следовательно и генетического кода нет. Ферменты аминоацил-тРНК-синтетазы можно представить такими техническими штучками, которые в автоматическом режиме дешифруют знак в смысл. Допустим унас есть 61 лекало, в котором есть три зоны, куда можно вставить 2х61 фишки, причем унас есть две разновидности фишек, которых форме 20 и 61 соответственно. Фермент-лекало не универсально, а их тоже 61 вида, то есть каждый индивидуальный фермент имеет индивидуальную конфигурацию позиции для 20 фишек первого рода, и 61 позицию для фишек второго рода. Фишки второго рода колодка имеют отверстие для присоединения фишки первого рода медали, у нас 20 медалей и 61 колодка. так вот чтобы процесс производства медалей с соответствующими колодками был без брака, на стоке 61 аминоацил-тРНК-синтетазы так выбраны гознаком чтобы каждая аминоацил-тРНК-синтетаза поглотив в отверстие определенную ей кодом определенную медаль, другая в эту позицию не встанет, возможно геометрия не позволит, тоже самое планка во вторую позицию аминоацил-тРНК-синтетазы не встанет если только она не будет поставлена в соответствие правильной медали, правило определено кодом Гознака. Госзнак использует 61 аминоацил-тРНК-синтетазу, когда правильные планка и медаль заняли правильные места на правильной аминоацил-тРНК-синтетазе, в третей зоне колечко соединяет правильно одну из 20 медалей с одной из 61 правильной планкой, бац бац и медведь готова. вероятность производственного брака на гознаке меньше 1/10000. 

(https://www.kamukamu.ru/media/543/543829.jpg)     
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 15.09.2020, 18:06:39
Это возражений не вызывает. А то здешние генетики всё говорят о каком-то коде ))
Код - это тот способ, которым информация записана. Например, двоичный код - информация передается отдельными битами. Буквенный код - так информация передается в книгах, с помощью определенного числа букв и специальных знаков. В ДНК используется четверичный код: 4 типа нуклеотидов.

Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 15.09.2020, 19:11:51
Код - это тот способ, которым информация записана. Например, двоичный код - информация передается отдельными битами. Буквенный код - так информация передается в книгах, с помощью определенного числа букв и специальных знаков. В ДНК используется четверичный код: 4 типа нуклеотидов.
Информация не обязательно передаётся через код. Для реализации кода нужен интерпретатор, действия которого  определяются не физико-химическими свойствами носителя информации, а смыслом, соотнесённым с кодом, который сам по себе условен. Такой интерпретатор в вашей схеме отсутствует.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 15.09.2020, 20:15:07
словом яблоко я обозначаю этот предмет я произношу яблоко вы подразумеваете то что на картинке изображено. триплет-кодон UCC обозначает генетическое слово, однозначный смысл которого раскрывается в аминокислоте Серин. Семантика налицо.
Триплет кодон ничего не обозначает (по крайней мере никто этого не показал), он просто, в полном соответствии с законами химии вступает в реакцию с соответствующей тРНК.
И никто при это ничего не подразумевает, никаких смыслов и семантики. там и подразумевать-то некому.
Разница очевидна.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 15.09.2020, 20:28:48
Меня вообще вот что удивляет - в науке постулат о генетической информации абсолютно мэнстрим. Огромное количество
статей, есть куча книг. Против этого понятия обычно были виталисты и структуралисты.
Зато тутошние атеисты ломают копья.
Абсурдная ситуация.
PS: С другой стороны они (форумные атеисты) более последовательны. В действительности, чтобы генетическая да и любая биологическая информация стала таковой нужен интерпретатор коим является организм, а для этого надо принять форму витализма. Или создать модифицированную теорию осмысливания информации.
"Тутошние форумные атеисты" полагают, что полезно понимать, информация и генетическая информация это две большие разницы.
Генетическая информация это не сведения и не представления, это объективная последовательность нуклеотидов в ДНК.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 15.09.2020, 20:39:45
PS: С другой стороны они (форумные атеисты) более последовательны.
В советское время такая позиция называлась "вульгарный материализм" и даже марксисты-ленинцы от него открещивались.

Типичный пример:
Цитировать
Триплет кодон ничего не обозначает (по крайней мере никто этого не показал), он просто, в полном соответствии с законами химии вступает в реакцию
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 15.09.2020, 20:46:26
Информация не обязательно передаётся через код. Для реализации кода нужен интерпретатор, действия которого  определяются не физико-химическими свойствами носителя информации, а смыслом, соотнесённым с кодом, который сам по себе условен. Такой интерпретатор в вашей схеме отсутствует.
Ферменты аминоацил-тРНК-синтетазы выступают в роли интерпретатора. Это белковая программа, которая сопоставляет антикодону тРНК строго определенный смысл в виде строго определенной аминокислоты. 
Алгоритм работы простого интерпретатора:
1. прочитать инструкцию;
Фермент аминоацил-тРНК-синтетазы это белок, четвертичная структура которого так сложена пространственно, что в неё, в её активные определенные функционально центры может проникнуть строго определенная аминокислота и соответствующая ей тРНК со строго определенным антикодоном. то есть аминокислота и тРНК умеют читать инструкцию и геометрически встраиваться в неё.
2. Проанализировать инструкцию и определить соответствующие действия;
Аминокислоты отличаются друг от друга радикалом, возможно и геометрией пространственного расположения радикала. Если фермент аминоацил-тРНК-синтетазы может встроить(поместить) в себя только Серин, то в зону куда помещается тРНК, то и тРНК должна уметь прочитать инструкцию, то есть туда может строится только одна из 61 тРНК, а менно  Сер-тРНК с УСС антикодоном. Если аминокислота Серин и Сер-тРНК с антикодоном УСС удачно встроились, ошибка меньше 1/10000. Если обе молекулы аминокислота и тРНК встроились в пространственную структуру фермента аминоацил-тРНК-синтетазы, то сама эта встроенность определяет конкретное действие привязки смысла к знаку. 

3. выполнить соответствующие действия;
(https://sun9-30.userapi.com/TrkVkmnf3I7J4-EfUuElG5fRlM8524rGBN-Vlg/_VvYqZorXBY.jpg)
Например, глицин-тРНК-синтетаза катализирует суммарную реакцию синтеза глицин-тРНК:
Gly + тРНК + ATP <-> Gly-тРНК + AMP + PP, (1)
включающую следующие две стадии:
E + Gly + ATP <-> E*(Gly-AMP) + PP, (2)
E*(Gly-AMP) + тРНК <->  E + AMP + Gly-тРНК, (3)
где E – фермент аминоацил-тРНК-синтетазы, Gly – глицин, ATP и AMP – аденозин-5'- три- и монофосфат соответственно, PP – пирофосфат, E*(Gly-AMP) – комплекс фермента с аминоациладенилатом, тРНК – специфическая глициновая тРНК, Gly-тРНК – глицин-тРНК.
E + AMP + Gly-тРНК это конечные действие отделения от фермента аминоацил-тРНК-синтетазы аминоацильного остатка аденозин-5'-монофосфата АМP и связанного по смыслу с аминокислотой глицин Gly-тРНКАМP и АМФ одно и тоже, также и ATP и ATФ, P и Ф основание фосфорной кислоты или фосфат. Пояснения для связки уравнений 1)2))3))) с рисунком, где интерпретация идет по кругу начиная с верхнего левого угла, где на рисунке показано условие  E + Gly + ATP, в правом верхнем углу действие приведшее к условию  E*(Gly-AMP) + PP АТР распадается на  РР и АМР, а АМРпроисходит активация аминокислоты с использованием энергии, запасенной в ATP  (Gly-AMP). Активированный аминоацильный остаток аденозин-5'-монофосфата АМФ в составе аминоацил-аденозин-5'-монофосфата или аминоацил-АМФ  переносится на одну из гидроксильных групп рибозного кольца концевого аденозина на CCA-конце тРНК, который соединяется с аминокислотой глицин, образуя соединение молекулы Gly-тРНК. В правом нижнем углу у нас такое условие E*(Gly-AMP) + тРНК, где в фермент E*(Gly-AMP) встречается подходящая тРНК. И наконец в левом нижнем углу показано как E + AMP + Gly-тРНК все три компонента разбегаются на все четыре стороны с образованием Gly-тРНК  .
4. если не достигнуто условие завершения программы, прочитать следующую инструкцию и перейти к пункту 2.
если аминокислота Серин удачно строилась в фермент аминоацил-тРНК-синтетазы, а на место тРНК пытается встроится с антикодоном Gly-тРНК, то фермент настроенный на Серин не позволит этой Gly-тРНК, у гайки и болта резьба разная. Такая Gly-тРНК отбрасывается и интерпретатор переходит к пункту 2 проанализировать инструкцию и определить соответствующие действия, пока не будет подобрана Сер-тРНК. 
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 15.09.2020, 21:12:05
Триплет кодон ничего не обозначает (по крайней мере никто этого не показал), он просто, в полном соответствии с законами химии вступает в реакцию с соответствующей тРНК.
И никто при это ничего не подразумевает, никаких смыслов и семантики. там и подразумевать-то некому.
Разница очевидна.
Фермент аминоацил-тРНК-синтетазы выступает в роли интерпретатора, её функциональные особенности таковы, что каждый фермент аминоацил-тРНК-синтетазы индивидуально заточен на определенную аминокислоту, в который может встроится только одна из 61 возможной тРНК со своим специфический триплетом антикодоном. Эта функциональная специфичность каждого фермента под определенную аминокислоту, наделяет смыслом или аминокислотой тот или иной триплет-антикодон на тРНК, и соответственно на мРНК треплет кодон и в конце концов на полинуклеотидной цепи ДНК. Знак это кодон смысл это аминокислота, ген это предложение смысл это белок или РНК.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 15.09.2020, 22:47:59
Фермент аминоацил-тРНК-синтетазы выступает в роли интерпретатора, её функциональные особенности таковы, что каждый фермент аминоацил-тРНК-синтетазы индивидуально заточен на определенную аминокислоту, в который может встроится только одна из 61 возможной тРНК со своим специфический триплетом антикодоном. Эта функциональная специфичность каждого фермента под определенную аминокислоту, наделяет смыслом или аминокислотой тот или иной триплет-антикодон на тРНК, и соответственно на мРНК треплет кодон и в конце концов на полинуклеотидной цепи ДНК. Знак это кодон смысл это аминокислота, ген это предложение смысл это белок или РНК.
Смысл, тут придумываете, исключительно вы, исходя из своего понимания. Сама аминоацил-тРНК-синтетаза никакими смыслами не задается и реагирует единственно для нее возможным способом.

Еще раз. Вам нужно показать что результаты работы ДНК обусловлены специфическим "кодом", а не естественными patterns, которые свойственны всем химическим соединениям.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 15.09.2020, 23:25:21
Смысл, тут придумываете, исключительно вы, исходя из своего понимания. Сама аминоацил-тРНК-синтетаза никакими смыслами не задается и реагирует единственно для нее возможным способом.
Её смысл или целенаправленная однозначная функция дешифратора кода записана в генах ДНК. Алгоритм работы простого интерпретатора полностью работает. Автор генома всё предусмотрел. конечно при абиогенезе на ряду с программой ДНК нужно паралельно было создавать комплексы ферментов и РНК, такие как тРНК и рРНК в одном месте и в одно время, вероятность такого случайного события стремится к нулю.   
Цитировать
Еще раз. Вам нужно показать что результаты работы ДНК обусловлены специфическим "кодом", а не естественными patterns, которые свойственны всем химическим соединениям.
вы можете разложить по полочкам выш специфический вкус, вы мне аркадия райкина напоминаете. Клетка это самовоспроизводящий автомат работающая по программе, шаблонно. Здесь смысл заданная целенаправленно функциональность. Ген имеет функциональный смысл, которым обладает колируемый белок или РНК. Вы хотите лирики, а тут функциональная технологическая карта процесса раскрывается, в этом закодированный смысл, не лирический, а функциональный. Смысл который закодирован в геноме функциональный живой организм, который закодирован в простой полинуклеотидной последовательности ДНК. Эта простая последовательность нуклеотидов в процессе транскрипции и трансляция раскрывается во всем сложном многообразии живого организма и это понимается под смыслом, сотни тысяч генетиков по всему миру ломают голову как понять этот смысл записанный в простой полинуклеотидной последовательности ДНК. а ведь всего то 5 нуклеотидов в качестве простого алфавита взяты, и их чередованиями можно записать кодом смысл структуры головного мозга. Всё это говорит, что тот Кто написал 4-мя нуклеотидами последовательность геном человека был сверхумным. кто вам не дает взять и повторить, написать геном единорога или дракона, главное вложить правильный смысл в последовательность нуклеотидов.       

Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 16.09.2020, 05:10:15
Именно так.
Наличие или отсутствие дырок на перфоленте это условный знак. Он определенным образом нанесен на перфоленту, перфолента с информацией отличается от перфоленты без информации. Я знаю кто и как нанес эти условные знаки.

Про последовательность нуклеотидов невозможно сказать, что она аналогичная. Чем она аналогична перфоленте? Нуклеотид это химическое соединение, которое реагирует с другими соединениями строго по законам химии.

Вам нужно показать, что что результаты работы ДНК обусловлены специфическим "кодом", а не естественными patterns, которые свойственны всем химическим соединениям.
Перфолента с информацией ни чем не отличается от перфоленты со случайным набором дырок. Так же и последовательность в ДНК с инфой от ваших ушей ничем не отличается от случайного набора нуклиотидов.

 В чём же тогда разница между перфолентой и ДНК с инфой от точно такими же но без инфы?

Перфолента передаёт информацию про ваши ущи по законам физики. А ДНК по законам физики и химии (там ещё есть физическое вращение вокруг своей оси и поступательные механические). И что? 

По вашему законы физики имеют преимущество перед суммой химио-физических в нашем споре?  :D


Условность это некая договоренность. Вот мы договорились, что дырка в перфоленте это 0, а отсутствие дырки 1, соответственно на это настроена машина, читающая перфоленту. Договорились о значении слов в языке. Поэтому и дырка в перфоленте и слово это условный знак.
А в ДНК никаких договоренностей нет, одна химия. А что вы имеете ввиду под "информация в генах предсказуема"? 
Есть прямая зависимость между геномом и строением организма, его свойствами  и тд. Зная это зависимость можно будет по геному делать справедливые выводы об организме в целом. Но, до полного понимания, тут еще очень и очень далеко.Не нужен. Новые функциональные гены возникают сами, без всякого программиста.
Если условность это договорённость разумной силы (а иначе никак, неразумная сила не договаривается), тогда в ДНК некая разумная сила договорилась считать эти гены - цветом ваших волос, а эти гены - размеры ваших ушей в миллиметрах. Абсолютная идентичность с набором дырок в перфоленте, которые кодируют тоже самое. Или покажите что здесь не так.

Если вы считаете, что до полного понимания ещё далеко, то почему абсолютно верите, что дело обходится без разумной силы? Абстрактное обозначение цвета ваших волос порядком нуклеотидов в генах - деятельность разумной силы.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 16.09.2020, 05:18:18
Конечно несут. Только тут ни при чем, ни языки, ни семантика вообще.
А раз нет семантики, то и автор не нужен.Уже объяснил. Отсутствуют условные знаки. Нету никаких абстрактных правил (договоренностей).
Конечно можно, таковыми правилами считать всю химию, но тогда получится, что любая молекула это код.
Как это нет языка? Вы его не видите, а учёные его видят:

https://www.gazeta.ru/science/2015/11/10_a_7882949.shtml

https://www.riatomsk.ru/article/20171014/tgu-issledovanie-dnk-genom/

взгляд программистов:

https://habr.com/ru/post/410103/

https://biomolecula.ru/articles/iazyk-programmirovaniia-dnk

Более того, учёные сейчас программируют ДНК клетки:  http://www.vechnayamolodost.ru/articles/gennaya-inzheneriya/programmirovanie-dnk-kak-i-zachem/

https://www.dailytechinfo.org/infotech/5227-uchenye-razrabotali-specialnyy-yazyk-dlya-programmirovaniya-processov-sozdaniya-sinteticheskoy-dnk.html

Более того, учёные обнаружили второй, скрытый слой информации в ДНК https://habr.com/ru/company/dronk/blog/395077/
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 16.09.2020, 05:25:05
И какая электронам с этого польза? :)
Что электрон от этого существует. Смысл его существования - создавать вселенную. Уберите это свойство и его не будет (нейтральные электроны аннигилируют после встречи с позитроном)

При чем тут пот, не нужно соскакивать. Мы говорили про цель человека. У человека есть свойство потеть. Полезное это свойство? Еще какое.
Если задать вопрос о цели человеческого потоотделения любой базарной мухе (при условии, что таковая умела бы говорить), она не задумываясь ответила бы, что смысл потоотделения  в том, что бы она, муха это ела. Более того, охлаждение организма это дополнительный положительный эффект, который позволяет человеку и дальше успешно выполнять свою главную целевую функцию - производить пот и еще кое-что, чем эта муха питается.
Цели человека конечно не в поте, они более глобальны. Но у пота есть цель. И у других частей человека есть цель. Откуда они взялись эти цели, как не создание разумной силы? Цель порождает только разум.



Лично я, и в ваших рассуждениях и в рассуждениях мухи, вижу одну и ту же ошибку. Очень наивно, не имея никаких тому доказательств, считать себя центром мироздания.
Док-ва есть: посмотрите вокруг себя, и вы обнаружите, что находитесь в центре мироздания - всё вращается вокруг вас. И вокруг меня. Каждый человек обнаруживает себя центром мироздания.

Кстати, вы никогда не задумывались, почему центр сознания (или мироздания) остановился именно на вашей личности? Не на другой личности, а именно на вас? Почему Вы находитесь не в теле Путина или Обамы, а именно в Модесте?  :)

Мне этот вопрос пришёл в голову лет в 6 и ответ на него нашёл только в религии.
Название: Re: Критерии искусственности объекта.
Отправлено: VasyaBit от 16.09.2020, 09:20:54
Кстати, вы никогда не задумывались, почему центр сознания (или мироздания) остановился именно на вашей личности? Не на другой личности, а именно на вас? Почему Вы находитесь не в теле Путина или Обамы, а именно в Модесте?  :)

Мне этот вопрос пришёл в голову лет в 6 и ответ на него нашёл только в религии.
Но есть и научный ответ на этот вопрос:
"Эгоцентризм - термин введён в психологию Жаном Пиаже для описания особенностей мышления, характерного для детей в возрасте до 8—10 лет. По различным причинам такая особенность мышления в разной степени выраженности может сохраняться и в более зрелом возрасте. "
Название: Re: Критерии искусственности объекта.
Отправлено: VasyaBit от 16.09.2020, 09:32:50
Но у пота есть цель. И у других частей человека есть цель. Откуда они взялись эти цели, как не создание разумной силы? Цель порождает только разум.
Вот только функция и цель это разные вещи.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 16.09.2020, 10:21:30
Триплет кодон ничего не обозначает (по крайней мере никто этого не показал), он просто, в полном соответствии с законами химии вступает в реакцию с соответствующей тРНК.
И никто при это ничего не подразумевает, никаких смыслов и семантики. там и подразумевать-то некому.
Разница очевидна.
Вы действительно прочитали мой комментарий #189?

Любой знак воздействует на реальность в соответствии с теми или иными естественными законами. Это касается и программы, управляющей полетом ракеты, и стихов, которые читает человек. Наличие "подразумевающего" тут совершенно ни при чем. Ракета будет лететь по своей программе, даже если все человечество исчезнет.
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 16.09.2020, 12:44:34
Но есть и научный ответ на этот вопрос:
Эгоцентризм
Речь в том сообщении шла не об эгоцентризме. Эгоцентризм это несколько другое.
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 16.09.2020, 12:50:10
В советское время такая позиция называлась "вульгарный материализм" и даже марксисты-ленинцы от него открещивались.
Любопытно, что современные атеисты все чаще сторонники вульгарного материализма, а не диамата, которого держались раньше официально.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 16.09.2020, 12:50:44
Любой знак воздействует на реальность в соответствии с теми или иными естественными законами.

Почему только знак?  :) Любая часть реальности воздействует на другие ее части, это не специфично для знака. Если нужно разобраться конкретно со знаками, нужно говорить о том, в чем специфика этого  воздействия.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 16.09.2020, 13:29:06
Почему только знак?  :) Любая часть реальности воздействует на другие ее части, это не специфично для знака.
Ну да. Причем согласно естественным законам и совершенно независимо от того, кто воздействует: человек или Бог.

Но уважаемый Модест почему-то использует при оценке ДНК аргумент: "Происходят реакции в полном соответствии с законами химии". Это мне непонятно. Какая разница?

Если нужно разобраться конкретно со знаками, нужно говорить о том, в чем специфика этого  воздействия.
Разумеется. Именно это я и попытался сделать в комментарии 189: понять, в чем отличие знака от того, что знаком не является. Мне кажется, в том, что знак не имеет ничего общего с тем, что он обозначает (денотатом). Соответственно, чтобы оказать влияние на реальность, уже имеющее отношение к денонату, знак должен пройти некоторую систему трансляции. И опять-таки неважно, выполняет эту трансляцию разумный человек, робот в ракете или рибосома.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 16.09.2020, 14:19:41
Разумеется. Именно это я и попытался сделать в комментарии 189: понять, в чем отличие знака от того, что знаком не является. Мне кажется, в том, что знак не имеет ничего общего с тем, что он обозначает (денотатом). Соответственно, чтобы оказать влияние на реальность, уже имеющее отношение к денонату, знак должен пройти некоторую систему трансляции. И опять-таки неважно, выполняет эту трансляцию разумный человек, робот в ракете или рибосома.

Именно. Но ДНК это молекула, непосредственно химически участвующая в биохимическом процессе в рибосоме или где там в клетке. Так что ДНК как набор знаков - сильная натяжка.
Знак связан  с денотатом чисто произвольным соглашением  между теми, что общается с помощью знака. два человека могут договориться и считать слово "Да" отрицание а слово "Нет" подтвержением. Вы не можете договориться с рибосомой об изменении соглашения, ибо его просто нет.  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 16.09.2020, 14:22:38
Знак связан  с денотатом чисто произвольным соглашением  между теми, что общается с помощью знака. два человека могут договориться и считать слово "Да" отрицание а слово "Нет" подтвержением. Вы не можете договориться с рибосомой об изменении соглашения, ибо его просто нет.  :)
Это уже "условный знак", далеко не все знаки условны.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 16.09.2020, 15:17:18
Именно. Но ДНК это молекула, непосредственно химически участвующая в биохимическом процессе в рибосоме или где там в клетке. Так что ДНК как набор знаков - сильная натяжка.
Ну вот жесткий диск совершенно точно содержит именно набор знаков, точнее, битов, закодированных с помощью магнитного поля. И, разумеется, этот диск непосредственно участвует в процесе выполнения программы, которая на нем записана. Собственно, это вообще самый шумный и активный элемент компьютера :) В чем вы усматриваете разницу с ДНК?

Знак связан  с денотатом чисто произвольным соглашением  между теми, что общается с помощью знака. два человека могут договориться и считать слово "Да" отрицание а слово "Нет" подтвержением. Вы не можете договориться с рибосомой об изменении соглашения, ибо его просто нет.  :)
Есть вопрос о том, что такое знак и как он передает информацию. А есть другой вопрос - зачем и кому все это нужно, договаривались ли об этом те или иные стороны. Вроде бы эта тема связана с первым вопросом, а не со вторым.

Да, в принципе люди могут изменить соглашение о том, что означают те или иные цепочки битов, записанные на диске, например, для представления слов в некотором языке. Правда, это делать не рекомендуется: стандарты вроде Unicode создаются как раз для того, чтобы таких изменений не было. И если кто-то и может здесь что-то поменять, то весьма немногочисленная прослойка человечества.

Но в любом случае - разве это важно, если мы хотим понять, знак это или нет? Если человечество неожиданно вымрет (не дай Бог), то компьютеры, созданные людьми, продолжат работать, читая и интерпретируя все те же самые знаки. Да и сегодня мы не в силах поменять денотаты, например, египетских иероглифов.

Предположим, выяснится, что, оказывается (!), миллиарды лет назад к нам прибыла могущественная цивилизация из иной галактики и разработала этот самый генетический код. Или, наоборот, будет установлено, что он возник естественным путем, без вмешательства разумных существ. (Как человек верующий, я придерживаюсь второй версии.) Но разве от этого как-то зависит, что представляет собой ДНК сегодня?
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 16.09.2020, 15:56:06
Ну вот жесткий диск совершенно точно содержит именно набор знаков, точнее, битов, закодированных с помощью магнитного поля. И, разумеется, этот диск непосредственно участвует в процесе выполнения программы, которая на нем записана. Собственно, это вообще самый шумный и активный элемент компьютера :) В чем вы усматриваете разницу с ДНК?

Переходите на SSD. :)
Все это работает лишь потому, что изготовители диска с одной стороны и разработчики OC с другой пришли к некоторому соглашению, какие команды (чтение, запись, поиск сектора) этот диск выполняет и как их кодировать. Как они пришли к соглашению -  отдельная песня. Возможно одна сторона навязала свои условности другой, возможно привлекли какие-то третьи организации, но так или иначе, соглашение состоялось.
И теперь знаковая система обмена данными между диском и другими частями компа работает, ибо обе стороны содержат программы, одинаково интерпретирующие эти знаки.

Здесь есть минимально необходимые признаки знаковой системы  - обмен знаками, соглашение о знаках.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 16.09.2020, 16:52:12
Переходите на SSD. :)
Уже :) Но они, заразы, пока дороже обычных при той же емкости. А большие диски тоже нужны.

Все это работает лишь потому, что изготовители диска с одной стороны и разработчики OC с другой пришли к некоторому соглашению, какие команды (чтение, запись, поиск сектора) этот диск выполняет и как их кодировать. Как они пришли к соглашению -  отдельная песня. Возможно одна сторона навязала свои условности другой, возможно привлекли какие-то третьи организации, но так или иначе, соглашение состоялось.
И теперь знаковая система обмена данными между диском и другими частями компа работает, ибо обе стороны содержат программы, одинаково интерпретирующие эти знаки.
Здесь есть минимально необходимые признаки знаковой системы  - обмен знаками, соглашение о знаках.
Обратите внимание на тот акцент, который я подчеркиваю.

Конкретно мы с вами, да, в курсе, что когда-то кто-то устанавливал какие-то соглашения. А порой и не устанавливали, просто делали, как технологически удобнее. Когда я разрабатываю те или иные протоколы, я порой ни с кем не советуюсь.

Но это стороннее знание. В самом диске как таковом нет ровно ничего, указывающего на тех людей, которые когда-то придумывали систему кодирования. И если тот же компьютер обнаружит через миллиард лет иная цивилизация, не подозревающая о существовании человечества, у нее не будет прямых доказательств, что тут было чье-то соглашение.

В этом отношении диск ничем не отличается от ДНК. Мы действительно не знаем, откуда взялась жизнь на Земле, и ее инопланетное происхождение, в том числе с участием иных цивилизаций в разработке генокодов - вполне легитимная научная гипотеза.

Но сами-то ДНК совершенно не меняются в зависимости от того, так это или нет! Мы не можем объявить ДНК "знаками" или "не знаками" в зависимости от того, что произошло миллиарды лет назад и что нам совершенно неизвестно. Они либо обладают свойствами знаков, либо нет. Здесь и сейчас. Следовательно, надо искать иные критерии искусственности.

Мне представляется, что таких критериев нет вообще: см. комментарий 177.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 16.09.2020, 17:03:06
Уже :) Но они, заразы, пока дороже обычных при той же емкости. А большие диски тоже нужны.
Обратите внимание на тот акцент, который я подчеркиваю.

Конкретно мы с вами, да, в курсе, что когда-то кто-то устанавливал какие-то соглашения. А порой и не устанавливали, просто делали, как технологически удобнее. Когда я разрабатываю те или иные протоколы, я порой ни с кем не советуюсь.

Но это стороннее знание. В самом диске как таковом нет ровно ничего, указывающего на тех людей, которые когда-то придумывали систему кодирования. И если тот же компьютер обнаружит через миллиард лет иная цивилизация, не подозревающая о существовании человечества, у нее не будет прямых доказательств, что тут было чье-то соглашение.

В этом отношении диск ничем не отличается от ДНК. Мы действительно не знаем, откуда взялась жизнь на Земле, и ее инопланетное происхождение, в том числе с участием иных цивилизаций в разработке генокодов - вполне легитимная научная гипотеза.

Но сами-то ДНК совершенно не меняются в зависимости от того, так это или нет! Мы не можем объявить ДНК "знаками" или "не знаками" в зависимости от того, что произошло миллиарды лет назад и что нам совершенно неизвестно. Они либо обладают свойствами знаков, либо нет. Здесь и сейчас. Следовательно, надо искать иные критерии искусственности.

Мне представляется, что таких критериев нет вообще: см. комментарий 177.
другими словами в любом код или в программе мы никаких условностей-соглашений не найдём. Они за пределами этого кода (языка, и.т.п.) и относятся к внешнему источнику. Поэтому странно слышать требование показать в коде ДНК некие соглашения.  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 16.09.2020, 17:10:32
Но есть и научный ответ на этот вопрос:
"Эгоцентризм - термин введён в психологию Жаном Пиаже для описания особенностей мышления, характерного для детей в возрасте до 8—10 лет. По различным причинам такая особенность мышления в разной степени выраженности может сохраняться и в более зрелом возрасте. "
Эгоцентри́зм (от др.-греч. ἐγώ — «я» и лат. centrum — «центр круга») — фактическая неспособность индивида рассматривать иную точку зрения, как заслуживающую внимания. Восприятие своей точки зрения как единственной существующей или даже единственно возможной.

Так что не к месту.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 16.09.2020, 17:18:29
другими словами в любом код или в программе мы никаких условностей-соглашений не найдём. Они за пределами этого кода (языка, и.т.п.) и относятся к внешнему источнику. Поэтому странно слышать требование показать в коде ДНК некие соглашения.  :)
Ну да, я о том же.

Отличие ДНК от велосипеда явно не в этом.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 16.09.2020, 17:35:34
Уже :) Но они, заразы, пока дороже обычных при той же емкости. А большие диски тоже нужны.
Обратите внимание на тот акцент, который я подчеркиваю.

Конкретно мы с вами, да, в курсе, что когда-то кто-то устанавливал какие-то соглашения. А порой и не устанавливали, просто делали, как технологически удобнее. Когда я разрабатываю те или иные протоколы, я порой ни с кем не советуюсь.

Но это стороннее знание. В самом диске как таковом нет ровно ничего, указывающего на тех людей, которые когда-то придумывали систему кодирования. И если тот же компьютер обнаружит через миллиард лет иная цивилизация, не подозревающая о существовании человечества, у нее не будет прямых доказательств, что тут было чье-то соглашение.

Значит, эти исследователи не смогут классифицировать обнаруженный диск как использующий знаковую систему.
Но на самом деле в  диске есть микросхемы-контроллеры и в них зашито какое-то алгоритмы.  При некоторой удаче иная цивилизация сможет их обнаружить и сделать простой вывод - а ведь можно было
011101011 назначить командой чтения, а 0001111 командой записи  - и все бы работало. Это признак знаковой системы.

Ищите микропрограмму в рибосоме, поменяв которую легко изменить смысл триплетов  :)

Следовательно, надо искать иные критерии искусственности.

Мне представляется, что таких критериев нет вообще: см. комментарий 177.
Критерий искуственности може существовать лишь в предположении, что мир в целом естественнен.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 16.09.2020, 20:30:40
Значит, эти исследователи не смогут классифицировать обнаруженный диск как использующий знаковую систему.
Но на самом деле в  диске есть микросхемы-контроллеры и в них зашито какое-то алгоритмы.  При некоторой удаче иная цивилизация сможет их обнаружить и сделать простой вывод - а ведь можно было 011101011 назначить командой чтения, а 0001111 командой записи  - и все бы работало. Это признак знаковой системы.
Ищите микропрограмму в рибосоме, поменяв которую легко изменить смысл триплетов  :)
Так нашли вроде? В митохондриях (https://ru.wikipedia.org/wiki/%D0%9C%D0%B8%D1%82%D0%BE%D1%85%D0%BE%D0%BD%D0%B4%D1%80%D0%B8%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0%D1%8F_%D0%94%D0%9D%D0%9A#%D0%9E%D1%81%D0%BE%D0%B1%D0%B5%D0%BD%D0%BD%D0%BE%D1%81%D1%82%D0%B8_%D0%BC%D0%B8%D1%82%D0%BE%D1%85%D0%BE%D0%BD%D0%B4%D1%80%D0%B8%D0%B0%D0%BB%D1%8C%D0%BD%D0%BE%D0%B9_%D0%94%D0%9D%D0%9A) код немного другой. Урацил вместо тимина. Другое "соглашение".
И вообще там немало вариаций, если верить той же Вики.

Мне кажется довольно очевидным, что и наша цивилизация, достигнув достаточного технологического уровня, сможет без проблем изменять коды в ДНК и РНК - точно так же, как сейчас мы изменяем кодировки символов. Компьютер есть компьютер, только маленький.

Критерий искуственности може существовать лишь в предположении, что мир в целом естественнен.
А разве наш мир может быть неестественным?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 16.09.2020, 20:35:43


Ищите микропрограмму в рибосоме, поменяв которую легко изменить смысл триплетов  :)
Критерий искусственности може существовать лишь в предположении, что мир в целом естественен.
http://orthodoxy.cafe/index.php?topic=657491.msg11362830#msg11362830
такая программа это фермент аминоацил-тРНК-синтетаза, она не в рибосоме. этот фермент белок так задан что он может из раствора вылавливать строго заданную аминокислоту, каждый из 61 только свою аминокислоту из 20. Он также может вылавливать из раствора 61 тРНК со своим специфическим антикодоном так что только одну из 61 тРНК, и пристегивать аминокислоту к тРНК. Поэтому этот набор 61 персональных аминоацил-тРНК-синтетаз наделяет триплет антикодон смыслом кодирования аминокислоты. 61 аминоацил-тРНК-синтетаза кодирует 61 тРНК смыслом 20 аминокислот.

(https://studydocs.ru/studfiles/41/916/615700/Биология%20в%202кн_кн1_Ярыгин%20Васильева%20и%20др_Учебник_2003%20-432с.doc_html_1bb716551d98b713.png)
если схематично представить механизм аминоацил-тРНК-синтетазы, то каждый фермент имеет специфические пазлы, под конкретную именную аминокислоту, их может быть 20 видов  пазлов на 61 аминоацил-тРНК-синтетазы, на пример Валин улавливается 4 из 61 аминоацил-тРНК-синтетазы, а Аргинин 6 из  61 аминоацил-тРНК-синтетазы, но каждая из 61 аминоацил-тРНК-синтетазы улавливает из раствора только свою персональную тРНК с персональным антикодоном. Поэтому Аргинин кодируют 6 тРНК с разными антикодонами, а Валин кодируют 4 тРНК с разными антикодонами. По этой причине специфичных аминоацил-тРНК-синтетаз имеем генетический код таким.
(https://s1.slide-share.ru/s_slide/6ee578fd81738e3a5590c50153e66d8a/adafee00-b2de-40f2-8270-279f2600d12b.jpeg)
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 20:36:17
Её смысл или целенаправленная однозначная функция дешифратора кода записана в генах ДНК. Алгоритм работы простого интерпретатора полностью работает. Автор генома всё предусмотрел. конечно при абиогенезе на ряду с программой ДНК нужно паралельно было создавать комплексы ферментов и РНК, такие как тРНК и рРНК в одном месте и в одно время, вероятность такого случайного события стремится к нулю.    вы можете разложить по полочкам выш специфический вкус, вы мне аркадия райкина напоминаете. Клетка это самовоспроизводящий автомат работающая по программе, шаблонно. Здесь смысл заданная целенаправленно функциональность. Ген имеет функциональный смысл, которым обладает колируемый белок или РНК. Вы хотите лирики, а тут функциональная технологическая карта процесса раскрывается, в этом закодированный смысл, не лирический, а функциональный. Смысл который закодирован в геноме функциональный живой организм, который закодирован в простой полинуклеотидной последовательности ДНК. Эта простая последовательность нуклеотидов в процессе транскрипции и трансляция раскрывается во всем сложном многообразии живого организма и это понимается под смыслом, сотни тысяч генетиков по всему миру ломают голову как понять этот смысл записанный в простой полинуклеотидной последовательности ДНК. а ведь всего то 5 нуклеотидов в качестве простого алфавита взяты, и их чередованиями можно записать кодом смысл структуры головного мозга. Всё это говорит, что тот Кто написал 4-мя нуклеотидами последовательность геном человека был сверхумным. кто вам не дает взять и повторить, написать геном единорога или дракона, главное вложить правильный смысл в последовательность нуклеотидов.       
У вас точно такая же ошибка, как у базарной мухи и Игоря Соколова, вы путаете свойство и цель. Цель капелек воды, по вашему, очевидно создавать снежинки.
Это, все очень красиво, но к сожалению очень голословно.
Подумайте, как можно фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 16.09.2020, 20:37:16
Мне кажется довольно очевидным, что и наша цивилизация, достигнув достаточного технологического уровня, сможет без проблем изменять коды в ДНК и РНК
О Франкенштейнах мечтаете?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 20:52:46
Перфолента с информацией ни чем не отличается от перфоленты со случайным набором дырок. Так же и последовательность в ДНК с инфой от ваших ушей ничем не отличается от случайного набора нуклиотидов.
 В чём же тогда разница между перфолентой и ДНК с инфой от точно такими же но без инфы?
На перфоленте я условные знаки показать могу, это отверстия, соответственно лента без отверстий будет лентой без условных знаков. А как вы отличите нуклеотид с условными знаками от нуклеотида без условных знаков?
Цитировать
Перфолента передаёт информацию про ваши ущи по законам физики. А ДНК по законам физики и химии (там ещё есть физическое вращение вокруг своей оси и поступательные механические). И что? 
По вашему законы физики имеют преимущество перед суммой химио-физических в нашем споре?  :D
Информация, кем то задуманная для передачи, определённым физическим образом нанесена на перфоленту.
Перфолента с информацией физически отличается от перфоленты без информации.
Лист бумаги с кириллицей на ней отличается от чистого листа бумаги.

Ничего подобного о нуклеотиде сказать нельзя.
Как вы предлагаете фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?
Цитировать
Если условность это договорённость разумной силы (а иначе никак, неразумная сила не договаривается), тогда в ДНК некая разумная сила договорилась считать эти гены - цветом ваших волос, а эти гены - размеры ваших ушей в миллиметрах. Абсолютная идентичность с набором дырок в перфоленте, которые кодируют тоже самое. Или покажите что здесь не так.
Здесь не так лишнее допущение про разумную силу. Поскольку у нас нет ни семантики, ни языка ни условных знаков, разумная сила отсекается бритвой старика Оккама.
Цитировать
Если вы считаете, что до полного понимания ещё далеко, то почему абсолютно верите, что дело обходится без разумной силы? Абстрактное обозначение цвета ваших волос порядком нуклеотидов в генах - деятельность разумной силы.
Вера тут совершенно ни при чем. Просто, я в соответствии с принципом "бритвы Оккама" исхожу из самого простого объяснения.

Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 21:08:20
Как это нет языка? Вы его не видите, а учёные его видят:
В данном случае, не ученые, а журналисты.
А во вторых, алфавит, язык и пр являются только аналогиями для понимания суперсложных процессов происходящих с ДНК.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 16.09.2020, 21:46:58
У вас точно такая же ошибка, как у базарной мухи и Игоря Соколова, вы путаете свойство и цель.
В генетическом коде свойство определяет цель.

Цитировать
Цель капелек воды, по вашему, очевидно создавать снежинки.
свойство молекулы Н2О при замедлении её движения, при понижении её кинетической энергии, остывании водного раствора собираться в кластеры. Вода при температуре 0 градусов цельсии кристаллизуется и эта её цель, капельки воды состоящие из молекул воды обретают форму снежинок потому что все молекулы соединяются друг с другом водородными связями, это кластеризация молекул воды имеют цель кристаллизации. Чистый раствор дистиллированной воды кристаллизуется в симметричные снежинки, грязный раствор содержащий гидрофильные и гидрофобные молекулы при кристаллизации имеет нарушение симметрии и снежинки имеют безобразный вид. Свойства определяют цель. 
(https://sun9-21.userapi.com/14eggUtvoNGcZSV2zKFxRg-xTHM8ztSb_FDf6w/b5ldBMjP8ow.jpg)

 
Цитировать
Это, все очень красиво, но к сожалению очень голословно.
Подумайте, как можно фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
Свойство нуклеотида комплементарность, поэтому у него цель образование комплементарной пары. свойство нуклеотидов это формирование сложноэфирными связями полинуклеотидные цепочки, а значит можно используя свойство комплементарности записывать информацию, копировать информацию и передавать информацию. Для записи смысловой единицы используется триплет кодон последовательность из трех нуклеотидов, которые могут создавать и взаимодействовать с комплементарным антикодоном. Каждому кодону на матричной мРНК существует антикодон на транспортной тРНК, точно также как каждому кодону ДНК на одной спирали имеется комплементарный антикодон на другой спирали. В рибосоме её свойства таковы, что её каталитические функции молекулярной машины таковы, что задана определенная цель доставить в рибосому нанизанную на матричную мРНК к месту соответствующего кодона антикодон тРНК, как только комплементарная связь сработала, прицепленный к тРНК аминокислота присоединяется к полипептидной цепи собираемого белка. Рибосома шагнула на шаг триплет, вытаскивает отцепленную от аминокислоты тРНК, которая ищет свою персональную  аминоацил-тРНК-синтетазу. Рибосома нашла новый триплет кодон на мРНК, а новая тРНК с соответствующим кодоном имеет свою цель определенную ей свойствами.         

Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации? В составе гена смысловая единица триплет, а не нуклеотид, как буква не имеет смысла в не контекста слова и предложения, только в контексте, так и нуклеотид не имеет смысла вне контекста триплета кодона и гена.
Цитировать
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?
в компьютере нет 0 и 1 там электрические сигналы, он либо есть, ибо его нет. управление целенаправленностью и последовательностью действий, приводящих к формированию и  и всё это записано в полинуклеотидной цепи ДНК. Самовоспроизводящийся автомат с программным обеспечением. 
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 21:47:36
Что электрон от этого существует. Смысл его существования - создавать вселенную. Уберите это свойство и его не будет (нейтральные электроны аннигилируют после встречи с позитроном)
С чего вы взяли, что это его цель? С чего, вы взяли, что у электрона вообще есть цель?
Цитировать
Цели человека конечно не в поте, они более глобальны.
Вот, видите, не нужно, подобно базарной мухе, спешить с выводами и путать свойство и цель.
Цитировать
Но у пота есть цель. И у других частей человека есть цель. Откуда они взялись эти цели, как не создание разумной силы? Цель порождает только разум.
У потовых желез есть разум? У других органов есть разум? Так с чего вы взяли, что у них есть цель?
Вы снова путаете цель и функцию.
Цитировать
Док-ва есть: посмотрите вокруг себя, и вы обнаружите, что находитесь в центре мироздания - всё вращается вокруг вас. И вокруг меня. Каждый человек обнаруживает себя центром мироздания.
Ваше, с позволения сказать, "доказательство" немедленно приводит нас в тупик. Только людей, как центров мироздания, будет семь миллиардов. А какое у нас право отказывать базарной мухе? Она тоже чувствует себя центром мироздания, уверяю вас. Так, что цель человека, похоже, именно потеть.
Цитировать
Кстати, вы никогда не задумывались, почему центр сознания (или мироздания) остановился именно на вашей личности? Не на другой личности, а именно на вас? Почему Вы находитесь не в теле Путина или Обамы, а именно в Модесте?  :)
Мне этот вопрос пришёл в голову лет в 6 и ответ на него нашёл только в религии.
Капитан очевидность тихонечко подсказывает нам, что вопроса тут никакого нет, мое сознание есть продукт деятельности нейронов расположенных в голове именно Модеста Матвеевича, как сознание Обамы есть продукт действия нейронов физически находящихся в голове Обамы. Очень просто.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 21:51:28
Вы действительно прочитали мой комментарий #189?
Любой знак воздействует на реальность в соответствии с теми или иными естественными законами. Это касается и программы, управляющей полетом ракеты, и стихов, которые читает человек. Наличие "подразумевающего" тут совершенно ни при чем. Ракета будет лететь по своей программе, даже если все человечество исчезнет.
Все материальное воздействует на реальность, но не все материальное знак.
Знак это соглашение (явное или неявное) о приписывании чему-либо какого-либо определённого смысла, значения.
знак вики (https://ru.wikipedia.org/wiki/%D0%97%D0%BD%D0%B0%D0%BA)
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 21:57:07
Но в любом случае - разве это важно, если мы хотим понять, знак это или нет? Если человечество неожиданно вымрет (не дай Бог), то компьютеры, созданные людьми, продолжат работать, читая и интерпретируя все те же самые знаки. Да и сегодня мы не в силах поменять денотаты, например, египетских иероглифов.
Предположим, выяснится, что, оказывается (!), миллиарды лет назад к нам прибыла могущественная цивилизация из иной галактики и разработала этот самый генетический код. Или, наоборот, будет установлено, что он возник естественным путем, без вмешательства разумных существ. (Как человек верующий, я придерживаюсь второй версии.) Но разве от этого как-то зависит, что представляет собой ДНК сегодня?
У пришельцев, которые через N лет обнаружат жесткий диск не возникнет никаких проблем с идентификацией этого предмета, как искусственного. Тут, даже не важно найдут они условные знаки или нет.

Что касается ДНК, то его искусственность тутошние форумные верующие и пытаются доказать через условные знаки. Только вот показать их никак не получается.
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 16.09.2020, 21:59:06
Все материальное воздействует на реальность
А как это лихо вы отделили материальное от реальности?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 16.09.2020, 21:59:50
Все материальное воздействует на реальность, но не все материальное знак.
Знак это соглашение (явное или неявное) о приписывании чему-либо какого-либо определённого смысла, значения.
знак вики (https://ru.wikipedia.org/wiki/%D0%97%D0%BD%D0%B0%D0%BA)
информация в строго заданной разумом последовательности кодонов в генах, от этой информации зависит то как РНК и белок будет принимать свертывание третичной структуры и от того как РНК и Белки будут формировать совместную четвертичную структуру молекулярных машин таких как рибосома и ферменты. От этой точной разумной информации зависит их функциональность и специфические каталитические свойства, та как будет выстраивается весь живой организм, как он будет функционировать.   
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 22:04:23
В генетическом коде свойство определяет цель.
Почему?
Цитировать
Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации? В составе гена смысловая единица триплет, а не нуклеотид, как буква не имеет смысла в не контекста слова и предложения, только в контексте, так и нуклеотид не имеет смысла вне контекста триплета кодона и гена.в компьютере нет 0 и 1 там электрические сигналы, он либо есть, ибо его нет. управление целенаправленностью и последовательностью действий, приводящих к формированию и  и всё это записано в полинуклеотидной цепи ДНК. Самовоспроизводящийся автомат с программным обеспечением.
Я вас не про смысл спрашиваю, а про условные знаки. Про перфоленту, жесткий диск, бумагу, можно сказать, когда условные знаки там есть, а когда нет. Как ген с условными знаками отличить от такого, но без таковых?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 22:06:04
информация в строго заданной разумом последовательности кодонов в генах, от этой информации зависит то как РНК и белок будет принимать свертывание третичной структуры и от того как РНК и Белки будут формировать совместную четвертичную структуру молекулярных машин таких как рибосома и ферменты. От этой точной разумной информации зависит их функциональность и специфические каталитические свойства, та как будет выстраивается весь живой организм, как он будет функционировать.
Не путаем информацию с генетической информацией.
Есть квартал в котором вы живете, а есть квартал, в котором идете в отпуск. :)
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 16.09.2020, 22:06:43
У пришельцев, которые через N лет обнаружат жесткий диск не возникнет никаких проблем с идентификацией этого предмета, как искусственного. Тут, даже не важно найдут они условные знаки или нет.

Что касается ДНК, то его искусственность тутошние форумные верующие и пытаются доказать через условные знаки. Только вот показать их никак не получается.
В последовательности кодонов ДНК хранится информация, которую пришельцы идентифицируют как программу. Ученые всего мира пытаются прочитать эту программу. 
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 22:10:22
В последовательности кодонов ДНК хранится информация, которую пришельцы идентифицируют как программу. Ученые всего мира пытаются прочитать эту программу.
Программу, как последовательность реакций, обусловленную химическими свойствами самой ДНК.
Никакой семантики, вы пока показать не смогли. Увы.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 16.09.2020, 22:13:22
Урацил вместо тимина. Другое "соглашение".
Уточните, пожалуйста, кто тут с кем согласился? Урацил с тимином?   ;)
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 16.09.2020, 22:24:59
Почему?Я вас не про смысл спрашиваю, а про условные знаки. Про перфоленту, жесткий диск, бумагу, можно сказать, когда условные знаки там есть, а когда нет. Как ген с условными знаками отличить от такого, но без таковых?
Ген всегда кодирует белок или РНК. В ДНК есть повторяющиеся некодирующие последовательности, большая часть генома. Были попытки редактировать некодируемые повторяющиеся последовательности, изымали некоторые некодируемые участки, это проводило к негативным последствиям у подопытных животных, они начинали болеть болезнями, к которым раньше был иммунитет. Геном до сих пор полностью не изучен. Чтобы участок выполнял роль кодирующего гена его нужно правильно прописать. Начало предложения должно быть озаглавлено старт-кодоном, от которого начинается отсчёт кодируемых триплетов кодонов, а в конце поставить стоп-кодон. Эта и есть структура гена, вне этой структуры кодоны триплеты насчитываются.     
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 16.09.2020, 22:27:10
Ген всегда кодирует белок или РНК. В ДНК есть повторяющиеся некодирующие последовательности, большая часть генома. Были попытки редактировать некодируемые повторяющиеся последовательности, изымали некоторые некодируемые участки, это проводило к негативным последствиям у подопытных животных, они начинали болеть болезнями, к которым раньше был иммунитет. Геном до сих пор полностью не изучен. Чтобы участок выполнял роль кодирующего гена его нужно правильно прописать. Начало предложения должно быть озаглавлено старт-кодоном, от которого начинается отсчёт кодируемых триплетов кодонов, а в конце поставить стоп-кодон. Эта и есть структура гена, вне этой структуры кодоны триплеты насчитываются.     
И что? Вы опять хотите функцией подменить цель, безо всяких на то оснований.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 16.09.2020, 22:51:29
Уточните, пожалуйста, кто тут с кем согласился? Урацил с тимином?   ;)

Не согласятся урацил с тимином, чтобы урацил был вместо тимина в ДНК. Есть различия у тимина и урацила. Тимин - тот же урацил, но метилированный в позиции С-5 пиримидинового кольца. Гипотезу мира РНК предполагает первичными нуклеиновыми кислотами были именно РНК. Наличие у нуклеотидах РНК урацила объясняется энергетической выгодностью. Синтез урацила как неметилированного основания уходит значительно меньше энергии, чем для синтеза метилированного основания - тимина. Так бы пошла безбожная природа, если бы не включился высшей разум.
 
Причина в механизме репарации дезаминированного цитозина.(https://present5.com/presentation/3/39528490_140179539.pdf-img/39528490_140179539.pdf-19.jpg)
На рисунке процесс дезаминирование цитозина, то есть превращения цитозина в урацил. дезаминирование цитозина происходит чаще всего спонтанно. Это есть спонтанная мутация. Природа, в силу энергетической выгодностью  хотела бы  в составе ДНК втиснуть урацил вместо тимина, то было бы невозможно различить мутантную пару А-У от канонической пары А-У, и мутации эти со временем бы интенсивно накапливались. Разумный Бог не разрешил. благословение дано тимину. Но так как у тимина есть своеобразный маркер - метильная группа, то становится возможной репарация ДНК. Репарация РНК невозможна.
То есть, использование тимина в качестве одного из азотистых оснований для нуклеотидов ДНК было закреплено Богом из-за приведенной причины. Он повышает стабильность генетического аппарата.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 16.09.2020, 23:09:02
Не согласятся урацил с тимином...

То есть, использование тимина в качестве одного из азотистых оснований для нуклеотидов ДНК было закреплено Богом из-за приведенной причины. Он повышает стабильность генетического аппарата.
Ту вот в чём дело. Сергей напомнил Даниэлю, что кодовая система подразумевает соглашение. Даниэль это соглашение нашёл, но между кем и кем - не сказал. Поэтому я попросил уточнить
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 17.09.2020, 00:24:14
Ваше, с позволения сказать, "доказательство" немедленно приводит нас в тупик. Только людей, как центров мироздания, будет семь миллиардов. А какое у нас право отказывать базарной мухе? Она тоже чувствует себя центром мироздания, уверяю вас.
Глупо, однако. У мухи нет разума.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 17.09.2020, 01:22:09
Программу, как последовательность реакций, обусловленную химическими свойствами самой ДНК.
Программа здесь ключевое слово, как разумно определенная последовательность реакций. 
Цитировать
Никакой семантики, вы пока показать не смогли. Увы.
Кодон -> аминокислота. Ген -> белок(РНК), генотип -> фенотип.
(https://cf.ppt-online.org/files/slide/r/rBbJ9QRAj4yNZcYxOgpoM27DzsTIVdumFUaCw0/slide-9.jpg)
Ген это полинуклеотидная осмысленная последовательность знаков кодонов, смысл который раскрывается в механизме транскрипции программы и трансляции в функциональный смысл белка или РНК. Это же очевидно. Самовоспроизводящийся автомат самовоспроизводится на основании генетической программы, програмного кода, точно также работает и станок с программным управлением. Программа записана на полинуклеотидном носителе ДНК. Матричная мРНК оперативная память. На рибосоме как на процессоре информация с оперативной памяти транслируется в осмысленную функционально полипептидную последовательность белка в виде первичной структуры, которая сначала скручивается и уплотняется во вторичную структуру сложенной спирали, а затем эта упакованная скрученная спираль сворачивается или укладывается в троичную компактную структуру с определенными каталитическим свойствами. Несколько третичных структур формируются в четверичной структуре в формат молекулярной машины с заданными  первичной структурой последовательности определенных аминокислот. Именно от того как будет создана четверичная структура, где и как расположены активные центры зависит свойства молекулярной машины, фермента, или рибосомы. В ДНК вся эта информация записано линейно на полинуклеотидной последовательности. Записаны они со смыслом, который раскрывается в механизме транскрипции и трансляции, химические свойства ДНК к смыслу не относятся, смысл возникает в сознание мыслящего существа, мы видим не только общие закономерности, но и программу и технологическую карту транскрипции и трансляции смысла.       
(http://propionix.ru/thumb/2/HCN-IzoKD7P_GyleAn92pQ/r/d/sintez_belka.png)

Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 17.09.2020, 02:31:48
Ту вот в чём дело. Сергей напомнил Даниэлю, что кодовая система подразумевает соглашение. Даниэль это соглашение нашёл, но между кем и кем - не сказал. Поэтому я попросил уточнить
(https://myslide.ru/documents_3/6cb6d82e404e57761566777b4d578533/img31.jpg)
Третичная структура (или трёхмерная структура) — пространственное строение (включая конформацию) всей молекулы белка или другой макромолекулы, состоящей из единственной цепи.Третичная структура в значительной степени определяется первичной структурой. Усилия по предсказанию третичной структуры белка, основываясь на его первичной структуре, известны как задача предсказания структуры белка.
В стабилизации третичной структуры белка принимают участие:

1. ковалентные связи (между двумя остатками цистеина — дисульфидные мостики);
2. ионные связи между противоположно заряженными боковыми группами аминокислотных остатков;
3. водородные связи;
4. гидрофильно-гидрофобные взаимодействия. При взаимодействии с окружающими молекулами воды белковая молекула «стремится» свернуться так, чтобы неполярные боковые группы аминокислот оказались изолированы от водного раствора; на поверхности молекулы оказываются полярные гидрофильные боковые группы.
Третичную структуру имеют также многие молекулы нуклеиновых кислот; в частности, универсальную третичную структуру имеют молекулы тРНК.
(https://studfile.net/html/2706/361/html_PxU5N7rwk8.f7pm/img-brUStI.png)
(https://cf.ppt-online.org/files/slide/a/azjQ9lkCf4oIbBi3JEvAcSKLg1qx5H8TVYpFuU/slide-10.jpg)
и так третичная структура в значительной степени определяется первичной структурой, а первичная структура определяется последовательностью кодонов на матричной мРНК. это означает что местоположение каждого кодона кодирующего аминокислоту совершенно неслучайное. От правильно заданной последовательности нужных кодонов формируется правильная полипептидная последовательность на рибосоме первичная структура белка.
(https://present5.com/presentation/1/373304140_443644224.pdf-img/373304140_443644224.pdf-39.jpg)
Четвертичная структура — способ укладки в пространстве отдельных полипептидных цепей, обладающих одинаковой (или разной) первичной, вторичной или третичной структурой, и формирование единого в структурном и функциональном отношениях макромолекулярного образования. Специфичность четвертичной структуры белков проявляется в определенной конформационной автономии полипептидных фрагментов, входящих в состав макромолекулы белка. Вклад гидрофобных взаимодействий в стабилизацию третичной и четвертичной структуры белков весьма значителен: в случае третичной структуры на их долю приходится больше половины стабилизирующей силы.

Это уже готовая молекулярная машина, и как видим в основе лежит точно подобранная по смыслу полипептидная последовательность первичной структуры всех входящих компонент третичной структуры. То есть последовательность кодирующих кодонов на полинуклеотидной цепи ДНК должна быть разумно подобранной и точно выверенной под задачи четверичной структуры белка или комплекса белков и рРНК. Именно четверичная структура определяет функциональные и каталитические свойства молекулярных машин, ферментов, белков .
Если в полинуклеотидной цепи поменять местами кодоны, то изменится и третичная структура белка, изменится и функциональный смысл третичной и четвертичной структуры. последовательность кодонов в гене определяет третичную структуру и её функциональный смысл.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 17.09.2020, 08:45:53
Ту вот в чём дело. Сергей напомнил Даниэлю, что кодовая система подразумевает соглашение. Даниэль это соглашение нашёл, но между кем и кем - не сказал. Поэтому я попросил уточнить
Что же, неплохая логика: отрицаем существование субъектов, потому, что нет соглашения, а соглашение (при всех прочих его признаках) отрицаем потому что нет субъектов.
Сirculus vitiosus
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 17.09.2020, 09:44:57
Так нашли вроде? В митохондриях (https://ru.wikipedia.org/wiki/%D0%9C%D0%B8%D1%82%D0%BE%D1%85%D0%BE%D0%BD%D0%B4%D1%80%D0%B8%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0%D1%8F_%D0%94%D0%9D%D0%9A#%D0%9E%D1%81%D0%BE%D0%B1%D0%B5%D0%BD%D0%BD%D0%BE%D1%81%D1%82%D0%B8_%D0%BC%D0%B8%D1%82%D0%BE%D1%85%D0%BE%D0%BD%D0%B4%D1%80%D0%B8%D0%B0%D0%BB%D1%8C%D0%BD%D0%BE%D0%B9_%D0%94%D0%9D%D0%9A) код немного другой. Урацил вместо тимина. Другое "соглашение".
И вообще там немало вариаций, если верить той же Вики.

Что нашли? что H2O содержит атом кислорода, а H2 нет, а так это одно и тоже?  :)
Ну хорошо, митохондрию перепрошейте. 

А разве наш мир может быть неестественным?

Вопрос как раз чисто знаковый. Есть точка зрения, что "естественным" следует обозначать только строго созданное разумом. Высшим разумом. Такая знаковая система, понимаете ли. :)
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 17.09.2020, 11:28:57
Что же, неплохая логика: отрицаем существование субъектов, потому, что нет соглашения, а соглашение (при всех прочих его признаках) отрицаем потому что нет субъектов.
Сirculus vitiosus
Это не моя логика.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 17.09.2020, 13:31:27
Это не моя логика.
Модест Матвеевич как Камноедов из НИИ ЧаВо строит свою логику на постулате отсутствия соглашения, нет соглашения, нет и согласительной комиссии. а если нет согласительной комиссии не может быть и согласования.

Генетический код (англ. Genetic code) (https://ru.wikipedia.org/wiki/Генетический_код) — совокупность правил, согласно которым в живых клетках последовательность нуклеотидов (ген и мРНК) переводится в последовательность аминокислот (белок). Собственно перевод (трансляцию) осуществляет рибосома, которая соединяет аминокислоты в цепочку согласно инструкции, записанной в кодонах мРНК. Соответствующие аминокислоты доставляются в рибосому молекулами тРНК. Генетический код всех живых организмов Земли един (имеются лишь незначительные вариации), что свидетельствует о наличии общего предка.
(https://cf.ppt-online.org/files1/slide/8/8vaXWbDZnf0Vm76ocJlz4PNrgexGuRh9dCKyHMkF3/slide-33.jpg)
это признаки согласованности.

(https://present5.com/presentation/3/152549346_327760405.pdf-img/152549346_327760405.pdf-22.jpg)
Правила генетического кода определяют, какой аминокислоте соответствует триплет (три подряд идущих нуклеотида) в мРНК. За редкими исключениями[1], каждому кодону соответствует только одна аминокислота. Конкретная аминокислота может кодироваться более чем одним кодоном, есть также кодоны, означающие начало и конец белка. Вариант генетического кода, который используется подавляющим большинством живых организмов, называют стандартным, или каноническим, генетическим кодом. Однако известно несколько десятков исключений из стандартного генетического кода, например, при трансляции в митохондриях используются несколько изменённые правила генетического кода.
(https://cloud.prezentacii.org/18/09/75990/images/screen4.jpg)
Простейшим представлением генетического кода может служить таблица из 64 ячеек, в которой каждая ячейка соответствует одному из 64 возможных кодонов.

Соглашение налицо, установлены правила, но это не соглашение по Матвеичу, потому что нет согласительной комиссии утвердившей это соглашение. Но если есть соглашение, то наверное можно допустить что в прошлом согласительная комиссия утвердила единый для всей природы генетический код.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 17.09.2020, 14:02:41
(https://sun9-21.userapi.com/14eggUtvoNGcZSV2zKFxRg-xTHM8ztSb_FDf6w/b5ldBMjP8ow.jpg)
памятка что такое гидрофильные и гидрофобные молекулы.

(https://ds04.infourok.ru/uploads/ex/0050/00035baf-f6c0cf43/img33.jpg)
для построения жизни нужно создать особое изолированное место в водном растворе, своего рода колбу или пробирку с принципом кого надо впущать, а кого не надо выпущать(вышвыривать и непущать). Для этого хорошо подходят жиры липиды и трансмембранные умные или специализированные механизмы.
У липидов есть гидрофильная головка и длинный гидрофобный хвост.
(https://cf.ppt-online.org/files/slide/4/4gBUVsdGacJ3SYfoTb1rI2Wn78ZkeLvC9y5u0Q/slide-9.jpg)
совершенно естественно что капля масла поворачивает свои липиды гидрофильной головкой к воде, а гидрофобные хвосты имеют свойство при группирование липидов вытеснять молекулы воды, так формируется капля масла, но если внутри капли образуется капля из воды, то внешний и внутренний слой липидов ориентированный к воде разворачивается гидрофильными головками к воде, образуется билипидный слой.   


(https://cf.ppt-online.org/files/slide/o/OXZw2avuQBb5Lq0czTG1CMJDgo3ks7hUKl6F4p/slide-5.jpg)

(https://present5.com/presentation/2945853_111151028/image-25.jpg)
как на этой картинки показано.
(http://images.myshared.ru/9/542605/slide_11.jpg)
так в конце концов формируется естественная липидная пробирка со стенками мембранами. В первичном бульоне такого добра должно быть предостаточно.
(http://images.myshared.ru/17/1153475/slide_7.jpg)
для того чтобы нуклеотиды и аминокислоты проникали через мембрану нужно было в мембрану встроить трас-мембранные протеины, которые пущали одних, и не пущали других, хиральный фейс контроль чинили. Ведь внешняя водная среда хирально грязная, она открыта. Внутренняя водная среда под мембраной закрытая и поэтому может при наличии специального трансмембранного механизма хирального фейс контроля под мембраной создать хирально чистый набор. Но чтобы сборка полипептидных и ли полинуклеотидных цепей была продуктивной, целесообразно внутри мембранной протоклетке создать мембранные мини протоклетки с особым трансмембранным механизмом, которые пропускал по одному нужный нуклеотид к правильному концу полинуклеотидной цепи, полинуклеотидная цепь должна быть встроена в особый умный трансмембранный супер протеин - печатную машинку.  Другой конец полинуклеотидной цепи будущей ДНК через другой специальный трансмембранный протеин выходит наружу во внешнюю область хирально чистых нуклеотидов, где нет места урацилу,ну не прошёл фейс контроль урацил, из за своей мутационной ненадежности. Так вот разумно созданная полинуклеотидная цепь, попадя в правильный хирально чистых нуклеотидов раствор через комплементарный механизм создает себе комплементарную полинуклеотидную цепь. ДНК напечатана. Подобные специфические механизмы могут специализироваться на печати РНК и белков, всё зависит от умной специфики супер трансмембранные умных протеинов. Умные, в смысле Богом управляемых. То есть Бог создал универсальное множество, состоящее из специализированных подмножеств в ограниченном универсальным множеством пространстве, завод по производству и сборки клетки, которую за относительно короткое время и создает.       
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 17.09.2020, 15:07:49
Модест Матвеевич как Камноедов из НИИ ЧаВо строит свою логику на постулате отсутствия соглашения, нет соглашения, нет и согласительной комиссии. а если нет согласительной комиссии не может быть и согласования.
Насколько я понимаю, Модест просто-напросто считает порочной логикой обосновывать существование Бога  существованием сложных систем, а существование сложных систем - существованием Бога. Я с ним в этом согласен.  Причём за образец сложности берутся компьютерные программы )) Можно было не заморачиваться с компьютерами. Всё существующее, кроме созданного человеком, создано Богом. Таковое есть, следовательно, Бог есть.
 

Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 17.09.2020, 15:23:14
Насколько я понимаю, Модест просто-напросто считает порочной логикой обосновывать существование Бога  существованием сложных систем, а существование сложных систем - существованием Бога. Я с ним в этом согласен.  Причём за образец сложности берутся компьютерные программы )) Можно было не заморачиваться с компьютерами. Всё существующее, кроме созданного человеком, создано Богом. Таковое есть, следовательно, Бог есть.
так это он специально тут пытается дискуссию водить по замкнутому порочному кругу. чем отличается самовоспроизводящийся автомат клетки от полного замкнутого цикла производства завода производящего завод. Мы же не оспариваем авторства проектирования и постройки такого завода человеком. А так как самовоспроизводящийся автомат клетки это тоже завод, который человек не мог спроектировать и построить, значит что его спроектировал и построил другой разум. Внутреннего разума у Вселенной нет, делаем вывод что автор и строитель жизни внешний Разум, человек знает только одного кандидата Бога. Его знание косвенное, подобное познается подобным. Разум разумом.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 17.09.2020, 16:07:20
так это он специально тут пытается дискуссию водить по замкнутому порочному кругу. чем отличается самовоспроизводящийся автомат клетки от полного замкнутого цикла производства завода производящего завод. Мы же не оспариваем авторства проектирования и постройки такого завода человеком. А так как самовоспроизводящийся автомат клетки это тоже завод, который человек не мог спроектировать и построить, значит что его спроектировал и построил другой разум. Внутреннего разума у Вселенной нет, делаем вывод что автор и строитель жизни внешний Разум, человек знает только одного кандидата Бога. Его знание косвенное, подобное познается подобным. Разум разумом.
https://ru.wikipedia.org/wiki/Бог_белых_пятен
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 17.09.2020, 16:47:25
У пришельцев, которые через N лет обнаружат жесткий диск не возникнет никаких проблем с идентификацией этого предмета, как искусственного. Тут, даже не важно найдут они условные знаки или нет.
Почему вы так решили? Вы же сами видите контрпример: ДНК. Они могут быть результатом вмешательства достаточно могущественной цивилизации. (Или вы это оспариваете? Вроде даже наша генная инженерия приближается к этим возможностям.) И вот, как видите, уважаемые участники в затруднении, как это идентифицировать: мнения разделились.

Вы сами можете привести хоть одно существенное отличие между устройством ДНК-РНК и устройством компьютера? Кроме непроверяемых тезисов о том, что при возникновении ДНК-РНК "никто ни с кем не договаривался"?
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 17.09.2020, 16:49:45
Уточните, пожалуйста, кто тут с кем согласился? Урацил с тимином?   ;)
Простите, вы ведете диалог или пытаетесь уязвить собеседника?
Я отвечал на замечание Сергея: "Ищите микропрограмму в рибосоме, поменяв которую легко изменить смысл триплетов". Я привел пример изменения микропрограммы, дал ссылку на вики, где приведено гораздо больше таких различий, и аккуратно добавил кавычки.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 17.09.2020, 16:55:07
Ту вот в чём дело. Сергей напомнил Даниэлю, что кодовая система подразумевает соглашение. Даниэль это соглашение нашёл, но между кем и кем - не сказал. Поэтому я попросил уточнить
Любая кодовая система, рассматриваемая как объективный факт, ничего не подразумевает. Факты не умеют "подразумевать". ДНК существует объективно, жесткий диск существует объективно. Можно эти факты изучать, сопоставлять, сравнивать, а затем на основе проведенных наблюдений - классифицировать. Например, отнести к категории носителей информации и микропрограмм или не отнести.

С другой стороны, можно договориться, что мы, следуя вики, будем называть знаком результат некоторого соглашения, например, соглашения между людьми (поскольку уважаемые атеисты не знают никого другого, кто умеет договариваться). И тогда, да, разумеется, ДНК не является знаком, поскольку людей тогда еще не было. А буква - является. Но в этом случае данная тема из диалога про критерии искусственности автоматически вырождается в спор о терминах.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 17.09.2020, 17:01:39
Что нашли? что H2O содержит атом кислорода, а H2 нет, а так это одно и тоже?  :)
Ну хорошо, митохондрию перепрошейте. 
Вы же спрашивали о возможности вариаций. Вот, они возможны. А насчет "перепрошейте" - полагаю, через какое-то время наша генная инжерения, если наука будет продолжать развиваться, справится и с этим. Или вы считаете это принципиально невозможным?

Вопрос как раз чисто знаковый. Есть точка зрения, что "естественным" следует обозначать только строго созданное разумом. Высшим разумом. Такая знаковая система, понимаете ли. :)
Совершенно не понял ни смысл вашей фразы, ни ее отношение к дискуссии.

Я сказал, что не верю в неестественные миры. Естественное - это то, что существует в мире. Следовательно, мир естественен. Это тавтология. При чем тут разум, тем более высший - ума не приложу. Естественность нашего мира никак не зависит от того, создан он кем-либо или нет. Как не зависят, например, законы физики.

Ну, естественно :), при условии, что мы говорим о реальном мире. Для виртуальных миров компьютерных игр вполне подходит термин "искусственный". Такова терминологическая традиция: то, что создал человек, называют искусственным, а все остальное - естественным.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 17.09.2020, 18:24:58
Вы же спрашивали о возможности вариаций. Вот, они возможны. А насчет "перепрошейте" - полагаю, через какое-то время наша генная инжерения, если наука будет продолжать развиваться, справится и с этим. Или вы считаете это принципиально невозможным?
Совершенно не понял ни смысл вашей фразы, ни ее отношение к дискуссии.

Я сказал, что не верю в неестественные миры. Естественное - это то, что существует в мире. Следовательно, мир естественен. Это тавтология. При чем тут разум, тем более высший - ума не приложу. Естественность нашего мира никак не зависит от того, создан он кем-либо или нет. Как не зависят, например, законы физики.

Ну, естественно :), при условии, что мы говорим о реальном мире. Для виртуальных миров компьютерных игр вполне подходит термин "искусственный". Такова терминологическая традиция: то, что создал человек, называют искусственным, а все остальное - естественным.
искусственный тоже может быть естественным, когда разум соединяется с естественным материалом по средством управления мыслию естественного действия. Человек мыслию управляет телом, как инструменты манипулятором, мысли разумны и свободны, что позволяет манипулятор телу заниматься творческой активностью. Природные манипуляции подчинены принципу наименьшего действия, то есть она выбирает тот путь, где разность кинетической и потенциальной энергии минимальна. Поэтому природа не может построить дом,насыпать кучу камней может,но не дом построить. Для строительства дома нужно  разумное управление манипуляциями,нужна технологическая карта последовательных действий, возможно нужны параллельные дополнительные технологические карты, которые в нужный момент пересекаются. 
Мы имеем в наличии дом, но не знаем как он был построен, долго мы не знали, но вот наступил век научно технического прогресса и мы пещерные люди сали думать от общего к частному,начали разбирать дом на составные части, и оказалось что дом построен по некоторой технологической карте, и в конце концов сделали заключение, что первым действием было рытьё котлована под фундамент. благо мы на стенах своей пещеры запечатлели все шаги технологической карты производства дома. теперь мы пошли от частного к общему и собрали дом заново целым. А немного погодя организовали строительную компанию и переселили человечество из пещер в новые дома. наша естественная пещера была создана потоком воды, а дом мы уже не совсем уверены что камнепадом, похоже что его создал никому из пещерных людей неизвестный разум. Оказывается для его строительства нужно не только руками работать таскать камни,но и головой не только кушать. Камни тоже естественные, а не искусственные, вот только кирпич я искал среди известняковых россыпей, и не вкурил пока как его делать, но подумал, у кирпича прямоугольная форма, скопирую и вырежу из известняка я такой же кирпич. получилось наладил массовый выпуск прямоугольных блоков из известняка и мрамора. Там деревья прямоугольные, подумал дерева мягкое можно из кругляка делать прямоугольные длинные назову я их досками брусками. В конце концов до меня дошло что дом что я нашёл вне пещеры сделал такой же человек. Искусственно разумно и с использованием технологической карты. ДНК тоже вначале имело комплементарное соединение двух комплементарных кирпичиков нуклеотидов. Разобрав самовоспроизводящий автомат клетки на составляющие мы научимся тому как создать технологическую карту от простого к сложному как собрать клетку, мы сажем создавать драконов орков,гномов и эльфов. мы поймем что жизнь создавалась разумом с использованием продуманной технологической карты и она создана искусственно не случайными последовательными операциями и событиями, манипулируя естественными вещами молекулами. это критерий искусственности неслучайная продуманная разумом последовательностей действий и правильного выбора естественных вещей в построение от простого к сложному. Случайность всё рушит.       
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 17.09.2020, 18:41:22
Вы же спрашивали о возможности вариаций. Вот, они возможны. А насчет "перепрошейте" - полагаю, через какое-то время наша генная инжерения, если наука будет продолжать развиваться, справится и с этим. Или вы считаете это принципиально невозможным?

Вот глядя на эту перепрошивку и поговорим. А пока просто нет такой темы, за исключением спекуляций, типа почему бы электролиз воды не назвать декодированием.

Вы же спрашивали о возможности вариаций. Вот, они возможны. А насчет "перепрошейте" - полагаю, через какое-то время наша генная инжерения, если наука будет продолжать развиваться, справится и с этим. Или вы считаете это принципиально невозможным?
Совершенно не понял ни смысл вашей фразы, ни ее отношение к дискуссии.

Я сказал, что не верю в неестественные миры. Естественное - это то, что существует в мире. Следовательно, мир естественен. Это тавтология. При чем тут разум, тем более высший - ума не приложу. Естественность нашего мира никак не зависит от того, создан он кем-либо или нет. Как не зависят, например, законы физики.

Ну, естественно :), при условии, что мы говорим о реальном мире. Для виртуальных миров компьютерных игр вполне подходит термин "искусственный". Такова терминологическая традиция: то, что создал человек, называют искусственным, а все остальное - естественным.

Ровно об этом я и говорю. "Естественный" - это знак. С чем и как он соотносится в реальном мире - чистая языковая, терминологическая условность. Что и порождает дискуссии, здесь в частности,  с чем именно его следует соотносить. Вы привели свой вариант, есть и другие. Т.е. в этом случае  все признаки знаковой системы налицо.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 17.09.2020, 18:48:54
(https://elementy.ru/images/news/heterotrophic_protocell_model_600.jpg)
Гипотетическая простейшая протоклетка, питающаяся готовой органикой. Мембрана протоклетки растет за счет включения подходящих молекул из внешней среды. Делится протоклетка простым «разваливанием пополам» под действием внутренних или внешних физических сил. Основную «пищу» ее составляют активированные нуклеотиды. Они просачиваются сквозь мембрану и используются для самопроизвольного (неферментативного) размножения молекул нуклеиновых кислот (РНК, ДНК или каких-то их ранних модификаций). Рис. из обсуждаемой статьи в Nature (https://www.researchgate.net/publication/5328192_Template-directed_Synthesis_of_a_Genetic_Polymer_in_a_Model_Protocell)
Американские биологи сделали важный шаг к пониманию начальных этапов зарождения жизни. Им удалось создать «протоклетку» с оболочкой из простых липидов и жирных кислот, способную втягивать из окружающей среды активированные нуклеотиды — «кирпичики», необходимые для синтеза ДНК. Протоклетка не может самостоятельно осуществлять матричный синтез (репликацию) ДНК от начала и до конца, но успешно справляется с важнейшими этапами этого процесса, причем все реакции идут без участия каких-либо белков или других сложных биологических молекул-катализаторов.
(https://elementy.ru/images/news/mechanism_of_solute_permeation_600.jpg)
Схема прохождения полярных или слабозаряженных молекул сквозь двухслойную липидную мембрану. Молекула сначала прилипает к гидрофильным «головкам» липидов (выделены красным). Это приводит к изменению ориентации молекул липидов. При определенных условиях липиды могут «перекувырнуться» головками на другую сторону мембраны, увлекая за собой захваченную молекулу. Рис. из дополнительных материалов к обсуждаемой статье в Nature
Авторы нашли несколько вариантов состава мембраны, при которых ее проницаемость для рибозы оказывается высокой. Дальнейшие эксперименты проводились с двумя из этих вариантов. Первый из них — смесь миристолеиновой кислоты (Myristoleic acid) с ее же глицериновым моноэфиром (glycerol monoester of myristoleic acid). Эта смесь дает устойчивые пузырьки с хорошей проницаемостью, но у нее есть один недостаток: миристолеиновая кислота содержит 14 атомов углерода и одну двойную связь, и ее присутствие в «первичном бульоне» в достаточно высоких концентрациях считается маловероятным. Второй вариант — смесь декановой кислоты (Decanoic acid) с соответствующим глицериновым моноэфиром и декановым спиртом. Эта смесь ближе к реальности (то есть к тому, что могло быть в первичном бульоне), потому что в декановой кислоте всего 10 атомов углерода и нет двойных связей.

Затем авторы приступили к изучению проницаемости этих пузырьков по отношению к активированным нуклеотидам — тем «кирпичикам», из которых клетка собирает молекулы РНК и ДНК. Если реальные протоклетки были гетеротрофами, такие нуклеотиды должны были составлять их главную «пищу». Современные клетки используют нуклеотиды с тремя присоединенными к ним остатками фосфорной кислоты (нуклеотид-трифосфаты). Однако нуклеотид-трифосфаты, как выяснилось, наотрез отказываются проходить сквозь любые липидные мембраны. Причина в том, что они несут слишком сильный отрицательный заряд. У нуклеотид-дифосфатов и нуклеотид-монофосфатов заряд меньше, и им удается пройти сквозь миристолеиновые и декановые мембраны, но из таких «кирпичиков» ДНК сама собой не синтезируется.

Однако и здесь нашелся обходной путь. Нуклеотиды можно активировать иным способом — присоединив к ним вместо трех фосфатов один фосфат и молекулу имидазола (имидазол — простое органическое соединение, широко распространенное в живой природе и представляющее собой кольцо из трех атомов углерода и двух атомов азота; имидазол является составной частью одной из 20 «канонических» аминокислот — гистидина). Нуклеотиды, активированные имидазолом, годятся для синтеза ДНК и РНК, но имеют только один отрицательный заряд, а не четыре, как нуклеотид-трифосфаты. Такие нуклеотиды уже применялись ранее в экспериментах по синтезу нуклеиновых кислот без участия ферментов.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 17.09.2020, 19:18:55
Вот глядя на эту перепрошивку и поговорим. А пока просто нет такой темы, за исключением спекуляций, типа почему бы электролиз воды не назвать декодированием.
Ну так... уже (https://ru.wikipedia.org/wiki/%D0%98%D1%81%D0%BA%D1%83%D1%81%D1%81%D1%82%D0%B2%D0%B5%D0%BD%D0%BD%D1%8B%D0%B9_%D0%B3%D0%B5%D0%BD%D0%BE%D0%BC). Пусть не перепрошивка транслятора-РНК, но перепрограммирование самой ДНК давным-давно уже сделали: синтезировали искусственные ДНК, описывающие определенные белки.

А вот электролиз воды явно невозможно назвать декодированием. Там просто нечего декодировать. Была молекула H20, получились H и O. Что еще могло получиться? В чем "код", что можно перепрограммировать?

Еще проще: взяли кирпич, уронили на пол. Получились обломки кирпича. Разве это "декодирование"?

Для сравнения, химические реакции, выполняемые ферментом, уже имеют элементы декодирования. Фермент опознает строго определенные молекулы и ускоряет строго определенные реакции.

Ровно об этом я и говорю. "Естественный" - это знак. С чем и как он соотносится в реальном мире - чистая языковая, терминологическая условность. Что и порождает дискуссии, здесь в частности,  с чем именно его следует соотносить. Вы привели свой вариант, есть и другие. Т.е. в этом случае  все признаки знаковой системы налицо.
Мне кажется, что обсуждать условности терминологии, то есть спорить о терминах - потеря времени. Надо просто договориться "на берегу", что и чем мы называем, и обсуждать уже реально существующие вещи, а не термины.

ДНК и компьютеры существуют реально, объективно. Кирпичи и вода - тоже. Так давайте попробуем понять, что есть объективно общего у предметов, искусственно созданных единственным (пока) известным (вам) разумным существом: человеком. А затем проверим, есть ли аналогичные признаки у предметов, которые человек не создавал.

Какие из этого делать выводы - совершенно отдельный вопрос, выходящий за рамки данной темы. Можно не делать никаких. Можно предположить существование инопланетян. Если какие-то верующие сделают отсюда выводы о существовании Бога, я первый буду против.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 17.09.2020, 19:54:44
Ну так... уже (https://ru.wikipedia.org/wiki/%D0%98%D1%81%D0%BA%D1%83%D1%81%D1%81%D1%82%D0%B2%D0%B5%D0%BD%D0%BD%D1%8B%D0%B9_%D0%B3%D0%B5%D0%BD%D0%BE%D0%BC). Пусть не перепрошивка транслятора-РНК, но перепрограммирование самой ДНК давным-давно уже сделали: синтезировали искусственные ДНК, описывающие определенные белки.
Именно не. Путем тончайших биохимических манипуляций синтезирована новая молекула ДНК, сильно похожая на оригинал, но созданная другим путем и с некими отличиями.

Знаковые же системы не требуют никаких тонкой химии. Грубо и элементарно, тычем пальцем в предмет и даем имя. И общаемся уже используя этот знак, тыкать пальцем больше не надо.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 17.09.2020, 20:41:06
Именно не. Путем тончайших биохимических манипуляций синтезирована новая молекула ДНК, сильно похожая на оригинал, но созданная другим путем и с некими отличиями.

Знаковые же системы не требуют никаких тонкой химии. Грубо и элементарно, тычем пальцем в предмет и даем имя. И общаемся уже используя этот знак, тыкать пальцем больше не надо.
Я бы не сказал, что работа человеческого мозга, когда он "тыкает пальцем и дает имя", проще упомянутой вами тонкой химии. Скорее, совсем наоборот.

Но мы явно уклонились от темы. Я уже сказал, что не хочу обсуждать термин "знак". Мне неинтересно, кто и как дает значения знакам. Тем более что оба варианта - атеистический и монотеистический - приведет к ровно одинаковым выводам: никакое разумное существо никакого смысла в ДНК, скорее всего, не закладывало, они появились совершенно естественным путем в результате тех или иных реакций. А если и было "закладывание смысла", то это были инопланетяне или кто-то подобный, и опять-таки этот вывод одинаков и для атеизма, и для монотеизма.

Мне интересна суть темы. Если вам тоже, то давайте это и обсуждать: чем искусственный предмет отличается от естественного. Вне зависимости от того, кто и при каких обстоятельствах его создавал или не создавал.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 17.09.2020, 20:49:36
Я бы не сказал, что работа человеческого мозга, когда он "тыкает пальцем и дает имя", проще упомянутой вами тонкой химии. Скорее, совсем наоборот.

Но мы явно уклонились от темы. Я уже сказал, что не хочу обсуждать термин "знак". Мне неинтересно, кто и как дает значения знакам. Тем более что оба варианта - атеистический и монотеистический - приведет к ровно одинаковым выводам: никакое разумное существо никакого смысла в ДНК, скорее всего, не закладывало, они появились совершенно естественным путем в результате тех или иных реакций. А если и было "закладывание смысла", то это были инопланетяне или кто-то подобный, и опять-таки этот вывод одинаков и для атеизма, и для монотеизма.

Мне интересна суть темы. Если вам тоже, то давайте это и обсуждать: чем искусственный предмет отличается от естественного. Вне зависимости от того, кто и при каких обстоятельствах его создавал или не создавал.

Ну если со знаками разобрались, давайте к тому, что они обозначают. Так что Вы называете "естественным" и что "искусственным"? 
З.Ы. Я так понял, возвращаемся примерно в эту точку http://orthodoxy.cafe/index.php?topic=657491.msg11172688#msg11172688
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 17.09.2020, 23:37:39
Модест Матвеевич как Камноедов из НИИ ЧаВо строит свою логику на постулате отсутствия соглашения, нет соглашения, нет и согласительной комиссии. а если нет согласительной комиссии не может быть и согласования.
Соглашение налицо, установлены правила, но это не соглашение по Матвеичу, потому что нет согласительной комиссии утвердившей это соглашение. Но если есть соглашение, то наверное можно допустить что в прошлом согласительная комиссия утвердила единый для всей природы генетический код.
Вы, Александр, чудесно постите всякого рода познавательные картинки. Это, вы молодец. Очень жаль, что почти всегда картинки ваши не имеют никакого отношения к предмету. Про свойства ДНК вы напостили достаточно, но на мои вопросы ответов так и нет.

Как вы предлагаете фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?

Вы настаиваете на том, что ДНК это система кодирования, использующая условные знаки и следующая абстрактными правилами, упорядоченность в соответствии с которыми определённых элементов используется для передачи информации.
Я настаиваю на том, что наследственная "информация" в ДНК передаётся исключительно при помощи химических реакций, а "абстрактные правила" о которох вы говорите, это всего навсего причинно-следсвенные цепочки, подчиняющиеся законам природы.

Моё понимание подтверждается тем, что никаких условных знаков в ДНК мы не видим и продемонстрировать их вы не можете.
Всё, что мы можем наблюдать, это химические реакции подчиняющиеся не "абстрактным правилам", а законам физики и химии.
Если бы вы могли продемонстрировать хотя бы одну ступень в образовании ДНК в которой известные законы природы не работали бы, то можно было бы продолжить разговор о неких "абстрактных правилах". Но поскольку вы этого сделать не можете, то и говорить не о чем.

Более того. Есть ещё одна проблема с вашими сравнениями процессов в ДНК и системами кодирования / декодирования информации.
Если генетический код это тоже самое, что и код в програмировании или в шифровке, то и результаты приложения генетического кода в образовании ДНК должны быть идентичны резултатам приложения кода в создании программ или шифровок.

В програмировании и шифровании очевидным результатом применения кода, как системы передачи информации при помощи условных символов и знаков, является тот факт что код позволяет со 100%oй точностью размножить результаты применения любого конкретного кода и создать любое количество абсолютно точных копий финального продукта (программы, шифровки и тп) на основе любой отдельной закодированной информации.
Если генетический код, согласно вашему утверждению, это система передачи информации при помощи условных символов и знаков, то он обязан предоставить нам аналогичную возможность, а именно, со 100%й точностью воспроизвести результаты применения конкретного генетического кода и создать любое количество абсолютно точных копий финального продукта (ДНК) на основе любой отдельной "закодированной информации".

Если же прав я, и образование ДНК это умопомрачительной длины причинно-следственный каскад цепных химических реакций, то расчитывать на обнаружение не то,что скольких угодно, но даже двух идентичных финальных продуктов не приходится.

Пока что, наблюдения человечества указывают на то, что прав я. Ни один из клонированных живых организмов не имеет одинаковое ДНК и даже у однополых близнецов шансы иметь идентичный ДНК приблизительно 1 из 70 триллионов.

Но, как говорится, шанс всегда есть. Примените свойства компютерного кода к генетическому коду и создайте (или покажите существующую) хотя бы одну копию любого ДНК и тогда у вас появится аргумент. Пока вы этого не сделали, аргумента у вас нет.
Выдергивать из доступной информации только ту, которая соответсвует вашим убеждениям и игнорировать ту, которая ваши убеждения не просто ставит под сомнение, а разрывает их на куски, это не аргумент.
Это confirmation bias.

Ленчик
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 17.09.2020, 23:54:48
так это он специально тут пытается дискуссию водить по замкнутому порочному кругу. чем отличается самовоспроизводящийся автомат клетки от полного замкнутого цикла производства завода производящего завод. Мы же не оспариваем авторства проектирования и постройки такого завода человеком. А так как самовоспроизводящийся автомат клетки это тоже завод, который человек не мог спроектировать и построить, значит что его спроектировал и построил другой разум. Внутреннего разума у Вселенной нет, делаем вывод что автор и строитель жизни внешний Разум, человек знает только одного кандидата Бога. Его знание косвенное, подобное познается подобным. Разум разумом.
Давайте, на минутку, подумаем. Завод, о котором вы пишите, будет набит деталями и конструкциями, которые невозможно будет идентифицировать иначе чем искусственные. В ДНК никаких искусственных деталей мы не наблюдаем.
Искусственность ДНК, вы пытаетесь доказать через, якобы присутствующую там семантику, но пока ни доказать, что это семантика, ни просто показать хотя бы условные знаки, вы не можете.
Такие дела.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 18.09.2020, 00:00:27
Почему вы так решили? Вы же сами видите контрпример: ДНК. Они могут быть результатом вмешательства достаточно могущественной цивилизации. (Или вы это оспариваете? Вроде даже наша генная инженерия приближается к этим возможностям.) И вот, как видите, уважаемые участники в затруднении, как это идентифицировать: мнения разделились.
Вы сами можете привести хоть одно существенное отличие между устройством ДНК-РНК и устройством компьютера? Кроме непроверяемых тезисов о том, что при возникновении ДНК-РНК "никто ни с кем не договаривался"?
То же самое, что я писал Александру52. Компьютер состоит из деталей очевидно искусственного происхождения. Не известны природные процессы, результатом которых были бы болты и гайки. А ДНК ничего подобного не содержит. Соответственно, у пришельцев не будет никаких проблем опознать компьютер, как искусственный объект.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 18.09.2020, 02:06:18
Вы, Александр, чудесно постите всякого рода познавательные картинки. Это, вы молодец. Очень жаль, что почти всегда картинки ваши не имеют никакого отношения к предмету. Про свойства ДНК вы напостили достаточно, но на мои вопросы ответов так и нет.

Как вы предлагаете фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
нуклеотид не есть смысловая единица кода, смысловая единица кодон это триплет состоящий полинуклеотидной цепи из трех нуклеотидов. кадони кодирует аминокислоту или знак препинания, что подтверждается систематической проверкой. 
(https://s1.slide-share.ru/s_slide/6ee578fd81738e3a5590c50153e66d8a/adafee00-b2de-40f2-8270-279f2600d12b.jpeg) эта таблица экспериментально подтверждена.

если их можно систематически проверять, то есть подвергнуть проверкам, результатом чего может быть их опровержение.

Цитировать
Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации?
опять не нуклеотид, а треплет-кодон внизу в таблице, где аминокислоту не кодируют только стоп-кодоны, голубым выделены. И у них есть функциональный смысл. 
(https://theslide.ru/img/thumbs/f7a9591947fae42985eb388dfb269841-800x.jpg)
все это систематически проверено экспериментом.
(http://Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?)
Термин информация навязываете вы
С середины XX века термин «информация» превратился в общенаучное понятие, включающее обмен сведениями между людьми, человеком и автоматом, автоматом и автоматом; обмен сигналами в животном и растительном мире; передачу признаков от клетки к клетке, от организма к организму (например, генетическая информация); одно из основных понятий кибернетики.
Генетическая информация
Материал из Википедии — свободной энциклопедии

Генети́ческая информа́ция — информация о строении белков, закодированная с помощью последовательности нуклеотидов — генетического кода — в генах (особых функциональных участках молекул ДНК или РНК).

Генетическая информация определяет морфологическое строение, рост, развитие, обмен веществ, психический склад, предрасположенность к заболеваниям и генетические пороки организма. Реализация генетической информации происходит в процессе синтеза белковых молекул с помощью трех типов РНК: информационной (иРНК) (её также называют матричной РНК, мРНК), транспортной (тРНК) и рибосомальной (рРНК). При этом генетическая информация копируется с матрицы ДНК на мРНК в ходе транскрипции, а затем мРНК используется как матрица для синтеза белков в ходе трансляции.

Процесс передачи информации может идти:

в направлении ДНК → РНК → белок
в направлении РНК → ДНК при обратной транскрипции.
Передача генетической информации в направлении от белка к нуклеиновым кислотам, по-видимому, невозможна, в частности, из-за свойства вырожденности генетического кода.


Цитировать
Вы настаиваете на том, что ДНК это система кодирования, использующая условные знаки и следующая абстрактными правилами, упорядоченность в соответствии с которыми определённых элементов используется для передачи информации.
ДНК это двойная полинуклеотидная спираль.
(http://propionix.ru/thumb/2/u6eF9M0GAuvo0yPFXMwuQQ/680r/d/nukleotid_i_dnk.jpg)
ДНК это носитель закодированной генетической информации. Условные знаки возникают у вас в голове когда вы хотите расшифровать закодированную информацию, ну типа как на картинке.
абстрактные правила возникают у вас в голове, вы тут не виноваты абстрактное мышление присуще человеке. Я вам уже показывал даже с картинками как происходит транскрипция и трансляция закодированного функционального смысла.
Транскрипция – это процесс синтеза РНК на матрице ДНК. ДНК раскручивается на одном из участков. На одной из цепей содержится информация, которую необходимо скопировать на молекулу РНК – эта цепь называется кодирующей. Вторая цепь ДНК, комплементарная кодирующей, называется матричной. В процессе транскрипции на матричной цепи в направлении 3’ – 5’ (по цепи ДНК) синтезируется комплементарная ей цепь РНК. Таким образом, создается РНК-копия кодирующей цепи.(https://present5.com/presentation/48659320_420333843/image-62.jpg)
закодированная на участке ДНК информация скопирована на матричную мРНК, которая является физическим переносчиком информации, функциональный смысл закодированной информации станет ясен на рибосоме в процессе трансляции. 
(http://propionix.ru/thumb/2/HCN-IzoKD7P_GyleAn92pQ/r/d/sintez_belka.png)

связывают антикодон тРНК комплементарный кодону на мРНК с кодируемой аминокислотой аминоацил-тРНК-синтетазы, о которых говорилась выше.
(https://sun9-30.userapi.com/TrkVkmnf3I7J4-EfUuElG5fRlM8524rGBN-Vlg/_VvYqZorXBY.jpg)
Какие вы тут хотите абстракции и информации мне втюхать?
 
Цитировать
Я настаиваю на том, что наследственная "информация" в ДНК передаётся исключительно при помощи химических реакций, а "абстрактные правила" о которох вы говорите, это всего навсего причинно-следсвенные цепочки, подчиняющиеся законам природы.
так настаивайте, кто вам запрещает, только я то ту причем, об "абстрактные правилах" говорите вы тут, я о транскрипции и трансляции, а это экспериментально подтвержденные механизмы перевода генетической информации в функциональный смысл белка и РНК.

Цитировать
Моё понимание подтверждается тем, что никаких условных знаков в ДНК мы не видим и продемонстрировать их вы не можете.
зачем мне вашей голове условные знаки искать. есть генетический код и механизмы его декорирования прочтения и перевода в иной функциональный смысл, в белок и РНК.
Цитировать
Всё, что мы можем наблюдать, это химические реакции подчиняющиеся не "абстрактным правилам", а законам физики и химии.
(https://elementy.ru/images/news/heterotrophic_protocell_model_600.jpg)
Гипотетическая простейшая протоклетка, питающаяся готовой органикой. Мембрана протоклетки растет за счет включения подходящих молекул из внешней среды. Делится протоклетка простым «разваливанием пополам» под действием внутренних или внешних физических сил. Основную «пищу» ее составляют активированные нуклеотиды. Они просачиваются сквозь мембрану и используются для самопроизвольного (неферментативного) размножения молекул нуклеиновых кислот (РНК, ДНК или каких-то их ранних модификаций). Рис. из обсуждаемой статьи в Nature



Цитировать
Если бы вы могли продемонстрировать хотя бы одну ступень в образовании ДНК в которой известные законы природы не работали бы, то можно было бы продолжить разговор о неких "абстрактных правилах". Но поскольку вы этого сделать не можете, то и говорить не о чем.
я не пойму вас о каких "абстрактных правилах" вы говорите?
Цитировать
Более того. Есть ещё одна проблема с вашими сравнениями процессов в ДНК и системами кодирования / декодирования информации.
Если генетический код это тоже самое, что и код в программирования или в шифровке, то и результаты приложения генетического кода в образовании ДНК должны быть идентичны результатам приложения кода в создании программ или шифровок.
Для каждой из 20 аминокислот в клетках есть специальный фермент, осуществляющий синтез соответствующей аминоацил тРНК (общее название – аминоацил-тРНК-синтетазы, для краткости будем называть их синтетазами). Все ферменты этой группы катализируют реакции аминоацилирования тРНК по принципиально сходному механизму. Реакция сопряжена с расщеплением аденозин-5'-трифосфата (ATP) или по русски АТФ  и протекает в две стадии. На первой стадии происходит активация аминокислоты с использованием энергии, запасенной в ATP, а на второй активированный аминоацильный остаток аденозин-5'-монофосфата АМФ в составе аминоацил-аденозин-5'-монофосфата аминоацил-АМФ  переносится на одну из гидроксильных групп рибозного кольца концевого аденозина на CCA-конце тРНК, здесь Р = Ф, английская и русская буквы означающие остаток фосфорной кислоты или фосфат. Аминокислота прикрепляется к тРНК с отделением АМФ.


(https://sun9-30.userapi.com/TrkVkmnf3I7J4-EfUuElG5fRlM8524rGBN-Vlg/_VvYqZorXBY.jpg)
Например, глицин-тРНК-синтетаза катализирует суммарную реакцию синтеза глицин-тРНК:
Gly + тРНК + ATP <-> Gly-тРНК + AMP + PP, (1)
включающую следующие две стадии:
E + Gly + ATP <->  E*(Gly-AMP) + PP, (2)
E*(Gly-AMP) + тРНК <->  E + AMP + Gly-тРНК, (3)
где E – фермент, Gly – глицин, ATP и AMP – аденозин-5'- три- и монофосфат соответственно, PP – пирофосфат, E*(Gly-AMP) – комплекс фермента с аминоациладенилатом, тРНК – специфическая глициновая тРНК, Gly-тРНК – глицин-тРНК.

Как видно из уравнения (2), образующийся на первой стадии реакции аминоациладенилат Gly AMP, в котором остаток глицина активирован за счет гидролиза макроэргической связи ATP и отщепления пирофосфата PP, не покидает молекулы глицин тРНК-синтетазы, образуя с ней комплекс. Происходящий затем перенос аминоацильного остатка из Gly-AMP на глициновую тРНК (уравнение (3))  завершает реакцию аминоацилирования тРНК и приводит к освобождению фермента и AMP. Исключительно низкая частота ошибок при аминоацилировании тРНК (<10−4) является непременным условием реализации генетического кода. Дело в том, что при биосинтезе белков в рибосомах выбор аминокислоты, включающейся в растущую белковую цепь, зависит исключительно от адапторной молекулы тРНК, к которой она прикреплена. Если на предрибосомном этапе произошла ошибка и к тРНК присоединилась аминокислота, не соответствующая специфичности антикодона, то эта ошибка уже не может быть исправлена на последующих этапах белкового синтеза. При этом не имеет значения, при отборе какого из субстратов реакции (1) – тРНК или аминокислоты – ошиблась соответствующая аминоацил-тРНК-синтетаза. В любом случае продукт реакции (аминоацил-тРНК) будет включать в синтезирующуюся в рибосоме молекулу белка аминокислотный остаток, не соответствующий кодирующему триплету мРНК. Неудивительно, что в ходе эволюции выработались специфические механизмы отбора “правильных” субстратов для аминоацил-тРНК-синтетаз, обеспечивающие безошибочное аминоацилирование тРНК. В связи с особым значением этих механизмов для реализации генетической информации их называют иногда вторым генетическим кодом. Аденин на конце у всех без исключения тРНК, как то знает фермент что там в зоне петли антикодона находится.


Цитировать
В програмировании и шифровании очевидным результатом применения кода, как системы передачи информации при помощи условных символов и знаков, является тот факт что код позволяет со 100%oй точностью размножить результаты применения любого конкретного кода и создать любое количество абсолютно точных копий финального продукта (программы, шифровки и тп) на основе любой отдельной закодированной информации.
Если генетический код, согласно вашему утверждению, это система передачи информации при помощи условных символов и знаков, то он обязан предоставить нам аналогичную возможность, а именно, со 100%й точностью воспроизвести результаты применения конкретного генетического кода и создать любое количество абсолютно точных копий финального продукта (ДНК) на основе любой отдельной "закодированной информации".


Цитировать
Если же прав я, и образование ДНК это умопомрачительной длины причинно-следственный каскад цепных химических реакций, то рассчитывать на обнаружение не то,что скольких угодно, но даже двух идентичных финальных продуктов не приходится.

Цитировать
Пока что, наблюдения человечества указывают на то, что прав я. Ни один из клонированных живых организмов не имеет одинаковое ДНК и даже у однополых близнецов шансы иметь идентичный ДНК приблизительно 1 из 70 триллионов.

Цитировать
Но, как говорится, шанс всегда есть. Примените свойства компьютерного кода к генетическому коду и создайте (или покажите существующую) хотя бы одну копию любого ДНК и тогда у вас появится аргумент. Пока вы этого не сделали, аргумента у вас нет.
Выдергивать из доступной информации только ту, которая соответсвует вашим убеждениям и игнорировать ту, которая ваши убеждения не просто ставит под сомнение, а разрывает их на куски, это не аргумент.
Это confirmation bias.

Ленчик

Я вам про Януса Полуэктовича, а вы мне прор Выбегалло. я вам достаточно пояснил суть генетического кода, а вы мне про СС+. и АЛДАН.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 04:02:19

Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?
Ни как не отличить. Информация видна не на самом носителе, а на выходе - что в итоге получается. Или смотрим на наличие механизма декодирования, если он есть, то это программа.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 04:09:47
На перфоленте я условные знаки показать могу, это отверстия, соответственно лента без отверстий будет лентой без условных знаков. А как вы отличите нуклеотид с условными знаками от нуклеотида без условных знаков?Информация, кем то задуманная для передачи, определённым физическим образом нанесена на перфоленту.
Перфолента с информацией физически отличается от перфоленты без информации.
Лист бумаги с кириллицей на ней отличается от чистого листа бумаги.

Ничего подобного о нуклеотиде сказать нельзя.
Как вы предлагаете фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
Каким образом вы предлагаете отличить нуклеотид с информацией от нуклеотида без информации?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?Здесь не так лишнее допущение про разумную силу. Поскольку у нас нет ни семантики, ни языка ни условных знаков, разумная сила отсекается бритвой старика Оккама. Вера тут совершенно ни при чем. Просто, я в соответствии с принципом "бритвы Оккама" исхожу из самого простого объяснения.
Вы не внимательно читали - перфолента без информации, это  лента со случайными дырками. Эти две перфоленты друг от друга не отличишь. Точно так же как и ДНК полученную в пробирке со случайным порядком нуклеотидов от ДНК кодирующее ваши уши.

Семантику и грамматику учёные нашли в коде ДНК:

ГЕНОМ КАК ИНФОРМАЦИОННО-СЕМИОТИЧЕСКИЙ ФЕНОМЕН https://cyberleninka.ru/article/n/genom-kak-informatsionno-semioticheskiy-fenomen   /Золян С.Т. - д.ф.н. проф., Жданов Р.И. - д.х.н. проф./

Генетический язык: алфавиты, слова и семантика. /Тимофеев А.В. — д.т.н., проф./ саму работу загуглите

Я вам показал, что вы просили - наличие семантики в генах. Теперь по правилам жанра вы должны поменять свою точку зрения?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 04:22:21
В данном случае, не ученые, а журналисты.
А во вторых, алфавит, язык и пр являются только аналогиями для понимания суперсложных процессов происходящих с ДНК.
Так аналогия правильно описывает суперсложную ситуацию? Если не правильно, то приведите научную статью, где сказано, что ген.код - это на сам деле не код, что ген.алфавит - это не алфавит, и.т.п.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 04:33:36
С чего вы взяли, что это его цель? С чего, вы взяли, что у электрона вообще есть цель?Вот, видите, не нужно, подобно базарной мухе, спешить с выводами и путать свойство и цель.У потовых желез есть разум? У других органов есть разум? Так с чего вы взяли, что у них есть цель?
Вы снова путаете цель и функцию.Ваше, с позволения сказать, "доказательство" немедленно приводит нас в тупик. Только людей, как центров мироздания, будет семь миллиардов. А какое у нас право отказывать базарной мухе? Она тоже чувствует себя центром мироздания, уверяю вас. Так, что цель человека, похоже, именно потеть.Капитан очевидность тихонечко подсказывает нам, что вопроса тут никакого нет, мое сознание есть продукт деятельности нейронов расположенных в голове именно Модеста Матвеевича, как сознание Обамы есть продукт действия нейронов физически находящихся в голове Обамы. Очень просто.
А зачем объекту имеющему цель иметь разум? Машина имеет цель, но не имеет разум. Ложка, кастрюля имеют цель своего существования, но разума не имеют.

У электрона, так же как у ложки, кастрюли, компьютера, машины и.т.п. есть свои задачи, которые они реализуют от своих свойств-функций. Свойства-функции этих объектов определяют их целесообразность, цель и смысл их существования

Не важно, имеет муха сознании или нет - если что-то ей необходимо для существования, то это и имеет в себе цель и смысл существования. Если допустим, пот человека крайне необходим мухе (например какие-то важные для неё витамины/элементы), то помимо терморегуляции он будет ещё иметь цель подкармливать муху необходимым.  Точно так же яблоко на дереве, помимо цели размножения, имеет в себе цель подкармливать человека витаминами. Тогда можно сказать, что пот человека для мухи это то же самое, что яблоки на дереве для человека.

И почему вы находитесь в голове именно Модеста Матвеевича, а не И.Соколова? У меня ведь тоже есть нейроны. Вы не ответили на этот вопрос.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 04:38:23
Уточните, пожалуйста, кто тут с кем согласился? Урацил с тимином?   ;)
Ваш вопрос звучит так: кто с кем согласился - звук с буквой? Сами кодируемые элементы между собой явно не соглашаются. Задайте вопрос более корректно.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 04:44:04
Ту вот в чём дело. Сергей напомнил Даниэлю, что кодовая система подразумевает соглашение. Даниэль это соглашение нашёл, но между кем и кем - не сказал. Поэтому я попросил уточнить
А когда 1 человек придумывает шифр он с кем договаривается? Ясно, что сам с собой. Поэтому не нужно иметь два разумного агента для соглашения, достаточно 1.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 04:48:37
Вот глядя на эту перепрошивку и поговорим. А пока просто нет такой темы, за исключением спекуляций, типа почему бы электролиз воды не назвать декодированием.


Так учёные программируют ДНК, перепрошивают программу и получают новые свойства организма.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 18.09.2020, 08:08:59
А когда 1 человек придумывает шифр он с кем договаривается? Ясно, что сам с собой. Поэтому не нужно иметь два разумного агента для соглашения, достаточно 1.
Согласен.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 18.09.2020, 08:55:43
Так учёные программируют ДНК, перепрошивают программу и получают новые свойства организма.

А почему тогда электролиз воды не декодирование?
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 18.09.2020, 09:01:37
А когда 1 человек придумывает шифр он с кем договаривается? Ясно, что сам с собой. Поэтому не нужно иметь два разумного агента для соглашения, достаточно 1.

Сам с собой очевидно.  И эту договоренность запоминает. А если забудет, то зашифрованное сообщение станет для него такой же тарабарщиной как и для других (ну если конечно это не примитивный шифр из числа давно известных миру). Т. е. он не сможет передать информацию из данной точки пространства-времени в другую. Получается, что чисто физически, их двое - отправитель и получатель не тождественны.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 11:30:47
Сам с собой очевидно.  И эту договоренность запоминает. А если забудет, то зашифрованное сообщение станет для него такой же тарабарщиной как и для других (ну если конечно это не примитивный шифр из числа давно известных миру). Т. е. он не сможет передать информацию из данной точки пространства-времени в другую. Получается, что чисто физически, их двое - отправитель и получатель не тождественны.
Не, не так. Передаётся рабочий код с готовым механизмом дешифрации и сборки готового изделия, для которой 2 разумный агент не нужен. Это как если бы вы получили в наследство от бабушки 3-Д принтер с готовой программой изготовления бабушкиных любимых очков, например. При этом вам не обязательно знать, как работает программа и какие там договорённости в этой программе.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 18.09.2020, 11:36:24
Программу, как последовательность реакций, обусловленную химическими свойствами самой ДНК.
Никакой семантики, вы пока показать не смогли. Увы.
Печатные пятна в книге состоят из молекул краски. Отражённый от них свет воспринивается светочувствительными молекулами, разновидность пятна определяет совокупность многих молекул, из которых состоит мозг или компутер. Никакой семантики. Увы.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 18.09.2020, 12:39:12
Не, не так. Передаётся рабочий код с готовым механизмом дешифрации и сборки готового изделия, для которой 2 разумный агент не нужен.

"Передаётся " это когда есть откуда и куда, две разные точки в пространстве-времени. Физически, их двое, даже по жизни человек сейчас и он же через неделю иногда отличаются не слабо. :)
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 18.09.2020, 13:42:29
Так учёные программируют ДНК
Это вы откуда такую дивную информацию почерпнули?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 14:40:44
"Передаётся " это когда есть откуда и куда, две разные точки в пространстве-времени. Физически, их двое, даже по жизни человек сейчас и он же через неделю иногда отличаются не слабо. :)
Так и есть - гены со специальным механизмом декодирования передаются в разные точки пространства-времени от одного организма к другому при размножение.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 18.09.2020, 14:50:08
Это вы откуда такую дивную информацию почерпнули?


Более того, учёные сейчас программируют ДНК клетки:  http://www.vechnayamolodost.ru/articles/gennaya-inzheneriya/programmirovanie-dnk-kak-i-zachem/

https://www.dailytechinfo.org/infotech/5227-uchenye-razrabotali-specialnyy-yazyk-dlya-programmirovaniya-processov-sozdaniya-sinteticheskoy-dnk.html

Более того, учёные обнаружили второй, скрытый слой информации в ДНК https://habr.com/ru/company/dronk/blog/395077/ [/size]
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 18.09.2020, 15:01:02
Забористые фейк-ньюс ))
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 18.09.2020, 15:42:51
Ну если со знаками разобрались, давайте к тому, что они обозначают. Так что Вы называете "естественным" и что "искусственным"? 
З.Ы. Я так понял, возвращаемся примерно в эту точку http://orthodoxy.cafe/index.php?topic=657491.msg11172688#msg11172688
Скорее, вот в эту: http://orthodoxy.cafe/index.php?topic=657491.msg11362032#msg11362032

Я с самого начала предположил, что вопрос поставлен неправильно. Или недопоставлен.
Ваше мнение:
Выходит одно из двух, или естественное существует или критерий невозможен.
Верующие очевидно должны придерживаться второй точки зрения, ибо допустить существование чего-то абсолютно естественного, ни каким Богом не сотворенного, это с верой в Бога никак не совместимо.
Это мнение, однако, уместно лишь для язычества и категорически противоречит монотеизму. В язычестве, действительно, есть некие создания, подобные человеку, но несколько более могущественные, которые в какой-то момент сотворили наш мир. Постольку, поскольку они подобны человеку, можно сделать вывод, что мир искусственный: ведь то, что создано человеком и подобными созданиями, по определению называется искусственным. Если же речь идет обо всем известном мире, то вы правы, критерий естественности невозможен.

К той же точке зрения приводит, например, шуточная модель сотворения миров Трурлем и Клапауцием Лема. И к этой же точке зрения приводит вполне научное предположение (которое, собственно, Лем и пародирует), что во Вселенной существуют могущественные цивилизации и что они когда-то совершенно осознанно "запустили" биологическую эволюцию на нашей планете, спроектировав, в частности, код РНК/ДНК.

Но монотеизм исходит из позиции, что Бог абсолютен, что Он сотворил абсолютно все, включая пространственно-временной континуум и все законы физики. А из Его абсолютности, в свою очередь, следует, что установленные Им законы природы совершенны и что нарушать их Ему не нужно. (Строго говоря, некоторые богословы допускают существование некоторых исключений из общего правила: мол, иногда Бог нарушает Свои законы и совершает "чудо". Но это частные и локальные нарушения, допускаемые уже в наше время при диалоге с человечеством. Фундамент остается прежним: Бог сотворил весь мир со всеми его законами, в том числе вместе с эволюцией видов.)

Таким образом, если именно Бог сотворил мир и именно Он планировал нашу эволюцию, если никакие "цивилизации" и языческие боги в это не вмешивались, то мы приходим к точно таким же выводам, как и в случае атеизма: код РНК/ДНК должен был возникнуть естественным образом в результате тех или иных химических реакций.

Соответственно, я предлагаю вообще исключить "гипотезу Бога" из дискуссии: это не может влиять на результаты. Любой "Бог", который "вмешался" и "искусственным образом" запланировал генетический код, автоматически превращается в языческое божество или инопланетную цивилизацию, а это монотеистам неинтересно. Кроме этого, это просто отодвигает вопрос: а откуда, в таком случае, взялся генокод самих этих могущественных созданий?

Итак, вот мы имеем современный материальный мир с теми или иными реальными артефактами. Можем ли мы назвать критерий, по которому можно отличить искусственный артефакт от естественного? Кроме тавтологического: вот, мы знаем, кто именно его создал.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 18.09.2020, 15:48:05
Давайте, на минутку, подумаем. Завод, о котором вы пишите, будет набит деталями и конструкциями, которые невозможно будет идентифицировать иначе чем искусственные.
А как вы узнаете, что они искусственные, если ничего не знаете о цивилизации, построившей такой завод? Лем, например, моделировал такие ситуации в романе "Эдем". Вот, вроде бы завод. Да, механизмы, конвейеры... Но делает невесть что и непонятно зачем. А может, это вовсе не завод, а живой организм? Или роман Кларка "Свидание с Рамой". Там целый город-завод внутри космического корабля, построенный вроде бы... разумными раманами. Производит роботов. Но со временем возникает подозрение, что эти роботы и есть рамане, и что никаких других раман не существует.

Разумеется, если исходить из предположения, что создатели завода подобны человеку, то тогда, да, их изделия удастся идентифицировать как искусственные. Но это наиболее дурацкое из возможных предположений, учитывая разнообразие Вселенной. Оно уместно только для язычников, создававших богов по своему образу и подобию - чему, разумеется, сии боги охотно "подыгрывали".
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 18.09.2020, 15:52:34
То же самое, что я писал Александру52. Компьютер состоит из деталей очевидно искусственного происхождения. Не известны природные процессы, результатом которых были бы болты и гайки. А ДНК ничего подобного не содержит. Соответственно, у пришельцев не будет никаких проблем опознать компьютер, как искусственный объект.
См. мой предыдущий комментарий. "Очевидно" это лишь человеку, а не марсианину. А болты и гайки - просто признак крайнего несовершенства технологии. Со временем даже наша технология, очевидно, научится конструировать приборы на микроуровне молекулярных связей, и никаких грубых следов производства вроде "болтов и гаек" там уже не будет. Разве что шутки ради.

Вспомните монолит из "Одиссеи-2001". Да, технология, причем очень совершенная. Настолько совершенная, что во второй части такие монолиты превращают Юпитер в звезду. Но внешне это просто параллелепипед! Да, он непохож на обычные камни, кристаллов такой формы не бывает. Но и ДНК непохожа на молекулу воды.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 18.09.2020, 15:57:55
Так и есть - гены со специальным механизмом декодирования передаются в разные точки пространства-времени от одного организма к другому при размножение.

Гены или не гены выше достаточно сказано. Частный вопрос был, с кем человек договаривается когда чисто сам себе что-то записывает (шифром или открыто по русски - не важно). Вот сам сегодняшний с собой завтрашним и договаривается. А иногда и не договоривается.  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 18.09.2020, 17:57:16
Согласен.

РЕПЛИКАЦИЯ ДНК
Репликация ДНК – это процесс удвоения молекулы ДНК путем матричного синтеза. В большинстве случаев естественной репликации ДНК праймером для синтеза ДНК является короткий фрагмент РНК (создаваемый заново). Такой рибонуклеотидный праймер создается ферментом праймазой (ДНК-праймаза у прокариот, ДНК-полимераза у эукариот), и впоследствии заменяется дезоксирибонуклеотидами полимеразой, выполняющей в норме функции репарации (исправления химических повреждений и разрывов в молекле ДНК).

Репликация происходит по полуконсервативному механизму. Это значит, что двойная спираль ДНК расплетается и на каждой из ее цепей по принципу комплементарности достраивается новая цепь. Дочерняя молекула ДНК, таким образом, содержит в себе одну цепь от материнской молекулы и одну вновь синтезированную. Репликация происходит в направлении от 3’ к 5’ концу материнской цепи.
(http://propionix.ru/thumb/2/3oEnTehqjZ9DPgUxjgAMAQ/r/d/replikatsiya_dnk.jpg)
Рис.  Репликация (удвоение) молекулы ДНК

ДНК-синтез – это не такой сложный процесс, как может показаться на первый взгляд. Если подумать, то для начала нужно разобраться, что же такое синтез. Это процесс объединения чего-либо в одно целое. Образование новой молекулы ДНК проходит в несколько этапов:

1) ДНК-топоизомераза, располагаясь перед вилкой репликации, разрезает ДНК для того, чтобы облегчить ее расплетание и раскручивание.
2) ДНК-хеликаза вслед за топоизомеразой влияет на процесс «расплетения» спирали ДНК.
3) ДНК-связывающие белки осуществляют связывание нитей ДНК, а также проводят их стабилизацию, не допуская их прилипания друг к другу.
4) ДНК-полимераза δ (дельта), согласовано со скоростью движения репликативной вилки, осуществляет синтез ведущей цепи дочерней ДНК в направлении 5'>3' на матрице материнской нити ДНК по направлению от ее 3'-конца к 5'-концу (скорость до 100 пар нуклеотидов в секунду). Этим события на данной материнской нити ДНК ограничиваются.
(http://propionix.ru/thumb/2/zo9cDGrkAyhMKXp3dI1_pA/680r/d/replikatsiya_dnk.png)
Рис.  Схематическое изображение процесса репликации ДНК: (1) Отстающая цепь (запаздывающая нить), (2) Ведущая цепь (лидирующая нить), (3) ДНК-полимераза α (Polα), (4) ДНК-лигаза, (5) РНК-праймер, (6) Праймаза, (7) Фрагмент Оказаки, (8) ДНК-полимераза δ (Polδ), (9) Хеликаза, (10) Однонитевые ДНК-связывающие белки, (11) Топоизомераза.
(http://propionix.ru/d/skhema_replikativnoy_vilki_i_funktsii_fermentov_replikatsii.jpg)
Рис. Синтез отстающей цепи дочерней ДНК ( Схема репликативной вилки и функции ферментов репликации)


5) Непосредственно сразу после расплетания и стабилизации другой нити материнской молекулы к ней присоединяется ДНК-полимераза α (альфа) и в направлении 5'→3' синтезирует праймер (РНК-затравку) – последовательность РНК на матрице ДНК длиной от 10 до 200 нуклеотидов. После этого фермент удаляется с нити ДНК.

Вместо ДНК-полимеразы α к 3'-концу праймера присоединяется ДНК-полимераза ε.

6) ДНК-полимераза ε (эпсилон) как бы продолжает удлинять праймер, но в качестве субстрата встраивает дезоксирибонуклеотиды (в количестве 150-200 нуклеотидов). В результате образуется цельная нить из двух частей – РНК (т.е. праймер) и ДНК. ДНК-полимераза ε работает до тех пор, пока не встретит праймер предыдущего фрагмента Оказаки (синтезированный чуть ранее). После этого данный фермент удаляется с цепи.

7) ДНК-полимераза β (бета) встает вместо ДНК-полимеразы ε, движется в том же направлении (5'→3') и удаляет рибонуклеотиды праймера, одновременно встраивая дезоксирибонуклеотиды на их место. Фермент работает до полного удаления праймера, т.е. пока на его пути не встанет дезоксирибонуклеотид (еще более ранее синтезированный ДНК-полимеразой ε). Связать результат свой работы и впереди стоящую ДНК фермент не в состоянии, поэтому он сходит с цепи.

В результате на матрице материнской нити "лежит" фрагмент дочерней ДНК. Он называется фрагмент Оказаки.

8 ) ДНК-лигаза производит сшивку двух соседних фрагментов Оказаки, т.е. 5'-конца отрезка, синтезированного ДНК-полимеразой ε, и 3'-конца цепи, встроенного ДНК-полимеразой β.





Михай Вадимович РЕПЛИКАЦИЯ ДНК это начало процесса транскрипции и трансляции кода в функциональный смысл физического фермента или РНК. Выше приведенный пример нам показывает, что чтобы знаки кодоны обрели функциональный смысл белка или РНК, необходимо параллельно с написанием програмного кода на полинуклеотидным насилие ДНК вести сборки полипептидных и полинуклеотидных ферментов и РНК, независимо от сборки полинуклеотидной цепи ДНК. Абиогенез ДНК, ферментов и РНК должен идти паралельно и в одно время и в одном ограниченном липидной мембраной месте. нужно чтобы в этом месте случайным образом возникли полипептидные цепи 61 фермента-синтезы, которые свяжут определенную аминокислоту с 3'-АСС концом т РНК и таким образом антикодон обретёт функциональный смысл связанный с данной аминокислотой. Должны там же возникнуть случайно полинуклеотидные цепи рибосомной рРНК и полипептидные цепи белков, которые вместе сформируют рибосому. Должны случайным образом сформироваться полипептидные цепи тРНК с правильной L образной третичной  структурой и антикодоном кольцом. то есть должны независимо от формирования полинуклеотидной цепи ДНК, должны идти такие же случайные процессы случайной сборки и ДНК-полимераза α (Polα), и ДНК-лигаза, и РНК-праймер, и Праймазы,  и ДНК-полимераза δ (Polδ), и Хеликаза, и Однонитевые ДНК-связывающие белки, и Топоизомераза.
вы же понимаете что просто полинуклеотидная двойная спираль бессмысленная последовательность нуклеотидов, чтобы она обрела функциональный смысл нужны ферменты и РНК, которые нужно создавать паралельно при случайном абиогенезе достаточно близко друг от друга и возможно под липидной мембранной. но самое интересное что говорит об искусственном происхождении генетической информации ДНК это то что в процессе параллельной сборки полинуклеотидной цепи ДНК в эту последовательность внесена информация о сборке всех необходимых ферментов и РНК, необходимых для того чтобы самовоспроизводящийся программный автомат заработал и начал производить ферменты и РНК необходимые для его функционирования и самовоспроизводства. Но во время абиогенеза правил случай, если случай создал ферменты и РНК под устойчивой мембраной протоклетки, та как попала в ДНК генетическая информация о всех случайно создавшихся при абиогенезе ферментах? Это нам показывает что кто то записал на полинуклеотидной последовательности генетическую информацию о всех удачных ферментах и РНК во время случайного абиогенеза, или всё же абиогенез был не случайным процессом управляемым разумом?     

То есть Михай Вадимович,  я как Инженер должен создать полную группу заводов, разобрать их на винтики, и каждый винтик запрограммировать в программном коде, собрать все заводы и запустить программный код, который всю означенную полную группу заводов превращает в самовоспроизводящийся автомат. Именно этот программный код - программа работы всех заводов как единый механизм, говорит нам об Инженере, об искусственном происхождении самовоспроизводящегося автомата.   
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 18.09.2020, 18:09:11
РЕПЛИКАЦИЯ ДНК
...
Александр, со всем уважением... не могли бы вы не постить сюда популярные сведения из биологии, а давать вместо этого ссылки на источник?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 18.09.2020, 18:27:01
Александр, со всем уважением... не могли бы вы не постить сюда популярные сведения из биологии, а давать вместо этого ссылки на источник?
Дорогой Даниэль, популярные сведения я выделил цветом, их можете пропустить, мне нужно было показать, что кроме ДНК последовательности есть ещё необходимые условия, которые должны быть созданы при абиогенезе паралельно с созданием ДНК, чтобы программный код, закодированный полинуклеотидной ДНК-последовательности обрёл смысл программы.  А признак искусственности заключается в том что инженер создавший необходимые параллельные условия, в процессе создания ДНК внес их туда в виде программы-генов, кодирующих все эти необходимые условия - ферменты и РНК. Мой пост выделен обычным черным цветом. Ферменты и РНК при абиогенезе создавались отдельно от ДНК, но вся оних информация по воспроизводству этих ферментов и РНК была включена в ДНК. это признак неслучайности, а разумности.   

Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 18.09.2020, 18:54:20
То есть Михай Вадимович,  я как Инженер должен создать полную группу заводов, разобрать их на винтики, и каждый винтик запрограммировать в программном коде, собрать все заводы и запустить программный код, который всю означенную полную группу заводов превращает в самовоспроизводящийся автомат. Именно этот программный код - программа работы всех заводов как единый механизм, говорит нам об Инженере, об искусственном происхождении самовоспроизводящегося автомата.
Как понимаю, это аргумент нечленимой сложности? Его разбирает Докинз  в "Бог как иллюзия", гл.4, Нечленимая сложность.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 18.09.2020, 19:51:47
Как понимаю, это аргумент нечленимой сложности? Его разбирает Докинз  в "Бог как иллюзия", гл.4, Нечленимая сложность.

независимые механизмы ферменты создаются паралельно с программой, в которую вносится информация о этих независимых механизмах ферментах, механизм в физической фактуре и в кодовой формируются одновременно. как случайный процесс формирования полинуклеотидной цепи ДНК точно записал ген полипептидной цепи белка фермента, делая его информационную копию? при этом нет механизма копирования от фермента к ДНК.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 18.09.2020, 20:24:04
независимые механизмы ферменты создаются паралельно с программой, в которую вносится информация о этих независимых механизмах ферментах, механизм в физической фактуре и в кодовой формируются одновременно. как случайный процесс формирования полинуклеотидной цепи ДНК точно записал ген полипептидной цепи белка фермента, делая его информационную копию? при этом нет механизма копирования от фермента к ДНК.
Я не знаю, как формировался генетический механизм. Докинз рассказывает только про глаз и жгутиковый мотор. Некоторое количество лет назад глаз приводился в качестве примера неупрощаемой сложности, которая никак не могла сформироваться постепенно.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 18.09.2020, 22:41:26
Я не знаю, как формировался генетический механизм. Докинз рассказывает только про глаз и жгутиковый мотор. Некоторое количество лет назад глаз приводился в качестве примера неупрощаемой сложности, которая никак не могла сформироваться постепенно.
Я говорю о другом. ваш пример не в тему. я о том говорю, что во время абиогенеза, где в безбожной парадигме все процессы построения полипептидной цепи ферментов-белков должны идти случайным образом.
(https://cf.ppt-online.org/files/slide/b/bd0NWFGsm1rT3gMnq82jpY6JwhQXZCaBODi7EK/slide-3.jpg) полипептидная последовательность белка собирается присоединением аминокислоты к одному из концов пептидной связью показано желтым. Известно что каталитические свойства фермента зависят от пространственной третичной и четверичной структуры, а оно строго зависит от первичной структуры полипептидной цепи, какая аминокислота на коком месте стоит в цепи. Механизма переноса кода с полипептидной цепи белка на полинуклеотидную цепь ДНК не существует. При абиогенезе полинуклеотидной цепи ДНК, паралельно должны под липидной мембраной протоклетки идти сборки всех необходимых белков ферментов и РНК, для того чтобы мог возникнуть генетический код, процессы, репликации, транскрипции и трансляции. все они должны идти случайным образом, поэтому маловероятны, но они должны были идти случайным или неслучайным путем генной инженерии. Эти процессы абиогенеза ферментов независимы от процесса абиогенеза ДНК. Но вот в чем парадокс, эти независимые процессы построения ферментов с точностью до аминокислоты оказались закодированы триплетами нуклеотидов, на последовательности ДНК как то появились гены этих независимых от ДНК ферментов белков, что может скажите это виноват опять случай. Дело в том, как я уже говорил ранее, ферменты синтезы связывают аминокислоту с тРНК и её антикодоном. Эти ферменты строго настроены вбирать в своё внутреннее пространство строго определенные аминокислоты и строго определенные тРНК, каждой аминокислоте свой фермент-синтеза, и каждой тРНК своя фермент-синтеза, в результат мы имеем 61 антикодон на тРНК который кодирует 20 аминокислот. А каждому антикодону тРНК на матричной мРНК есть комплементарны кодон, а каждому кодону мРНК есть комплементарный колон на ДНК. Так вот каким то волшебным способом при абиогенезе ДНК в ней появились гены ферментов-синтез. Ферменты синтезы сами формировались, а гены сами если считать что все процессы случайные при общем абиогенезе, это невероятное событие, если конечно не допустить методы генной инженерии доступной сверх цивилизации, которая существует вне инад нашей Вселенной. Мы говорим что это Бог. Не может быть что одновременно формировался фермент-синтеза ответственная за работоспособность генетического кода и сам генетический кол кодировал эти 61 фермент-синтезы последовательностью генов кодирующих эти разные 61 фермент-синтезы. А разных ферментов очень и очень много и все они попали в ДНК в качестве генов.
(http://900igr.net/up/datas/37556/003.jpg)
Как попали ферменты и белки в последовательности генов при общим абиогенезе?
(http://900igr.net/up/datas/60123/021.jpg)
при этом при абиогенезе ферменты должны как то размножаться чтобы быть идентичными по функциям и в достаточном количестве, а управляет сборкой слепой случай или всё же Генный Инженер? Иначе вероятность возникновения жизни будет практически нулевой.     
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 19.09.2020, 04:30:51
Как понимаю, это аргумент нечленимой сложности? Его разбирает Докинз  в "Бог как иллюзия", гл.4, Нечленимая сложность.
Он делает видимость, что разбирает. А если подумать, то Докин упирается в не разрешаемый тупик:

1. Все мутации случайны и хаотичны.

2. Нет закрепляющего механизма полезных мутаций. Если случайно возникло что-то полезное, то в следующую секунду это должно быть разрушено следующей случайной мутацией.

Исходя из этого, ничего сложнее хаотичного набора нуклеотидов получится не может, не говоря уже о глазе.

Если всё же получился полезный сложный орган и он не разрушается от последующих мутаций, то логически приходим к выводу:

1. Есть мутации не случайные и не хаотичный.

2. Существует неизвестный механизм защиты только полезных мутаций от последующих отрицательных и разрушительных изменений, что напрямую связано с пунктом 1.

Но по факту, существует механизм сохранения всего ряда ген от любых изменений и полезных и отрицательных, специальный высокотехнологичный блок контроля следит за ошибками в репликации и удаляет бракованную нить, отличающейся от исходной.

Про нечленимую сложность можно привести ещё такой аргумент: производство инсулина и других гормонов. Ни какая эволюция от простого к сложного в производстве гормонов не может быть в принципе - инсулин или есть или его нет. Технология производства могла быть получена только сразу в готовом виде.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 19.09.2020, 04:57:34
Забористые фейк-ньюс ))
Не обманывайте. Там есть ссылка на первоисточник, рецензируемый журнал Science:

https://science.sciencemag.org/content/352/6281/aac7341

перевод с англ названия статьи: "Автоматизация проектирования генетических схем. Схема программирования для синтетической биологии."

И вообще, генетическую инженерию не рассматриваете как программирование ДНК?
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 07:20:51
управляет сборкой слепой случай или всё же Генный Инженер? Иначе вероятность возникновения жизни будет практически нулевой.   
Принимая во внимание исключительно низкую вероятность, которую мы наблюдаем в живых организмах, случай решением быть не может, и ни один здравомыслящий биолог никогда этого не заявлял. (Докинз).
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 07:37:44
2. Существует неизвестный механизм защиты только полезных мутаций от последующих отрицательных и разрушительных изменений, что напрямую связано с пунктом 1.
Есть естественный отбор. Он не защищает, но полезные мутации остаются.
Цитировать
Про нечленимую сложность можно привести ещё такой аргумент: производство инсулина и других гормонов. Ни какая эволюция от простого к сложного в производстве гормонов не может быть в принципе - инсулин или есть или его нет. Технология производства могла быть получена только сразу в готовом виде.
В чём отличие от аргумента про невозможность постепенного формирования глаза?
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 19.09.2020, 09:47:55
Принимая во внимание исключительно низкую вероятность, которую мы наблюдаем в живых организмах, случай решением быть не может, и ни один здравомыслящий биолог никогда этого не заявлял. (Докинз).
Если это не случай, то это детерминизм от начала. И вы не находите это странным?
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 10:55:20
Я говорю о другом. ваш пример не в тему. я о том говорю, что во время абиогенеза, где в безбожной парадигме все процессы построения полипептидной цепи ферментов-белков должны идти случайным образом.
Извините, не понял, что вы про абиогенез. Про абиогенез Докинз рассуждает в параграфе "Антропный принцип: планетарный вариант" 4-й главы.
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 19.09.2020, 11:06:59
Докинз
И что вы в нем нашли? Он утверждает, что человек есть средство выживания генов. Это адекватно?
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 11:08:27
Если это не случай, то это детерминизм от начала. И вы не находите это странным?
И не детерминизм. Случай вносит свой вклад и в мутации, и во влияние среды. Неохота пересказывать, прочтите 4-ю главу и потом, если вопрос не снимется, снова его задайте.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 11:22:09
И что вы в нем нашли? Он утверждает, что человек есть средство выживания генов. Это адекватно?
Вроде, демагогия пошла в ход? Неадекватный в одном может быть вполне адекватным в другом. А формулировка "человек есть средство выживания генов" (если таковая есть у Докинза, я из него прочитал только 4-главу книги "Бог как иллюзия") имеет, скорее всего, не буквальный смысл, так как ген сам по себе не живой. Тогда и это адекватно.
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 19.09.2020, 11:36:28
И не детерминизм. Случай вносит свой вклад и в мутации, и во влияние среды.
Сочетание случайности и целенаправленности?
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 19.09.2020, 11:39:56
А формулировка "человек есть средство выживания генов" (если таковая есть у Докинза, я из него прочитал только 4-главу книги "Бог как иллюзия") имеет, скорее всего, не буквальный смысл, так как ген сам по себе не живой. Тогда и это адекватно.
Т. е. вы готовы согласиться с тем, что в эволюции основное это гены, а организмы - побочный продукт?
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 11:59:46
Вроде, демагогия пошла в ход? Неадекватный в одном может быть вполне адекватным в другом. А формулировка "человек есть средство выживания генов" (если таковая есть у Докинза, я из него прочитал только 4-главу книги "Бог как иллюзия") имеет, скорее всего, не буквальный смысл, так как ген сам по себе не живой. Тогда и это адекватно.
Не читал Докинза (кроме некоторых выдержек), но сама идея, что гены обладают волей, а организмы - их средство выживания и распространения, весьма популярна у современных эволюционистов и особенно у социал-дарвинистов. Ссылок не будет. Это вывод из читанного в разных местах в разное время и как правило 5-15 лет тому.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 12:24:35
Сочетание случайности и целенаправленности?
Да, с появлением существ, имеющих цели, целенаправленность стала фактором эволюционного процесса.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 12:25:37
Т. е. вы готовы согласиться с тем, что в эволюции основное это гены, а организмы - побочный продукт?
Для кого основное?
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 19.09.2020, 13:00:56
Для кого основное?
А вот выше вам Владимир Витальевич все объяснил.
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 19.09.2020, 13:01:49
Да, с появлением существ, имеющих цели, целенаправленность стала фактором эволюционного процесса.
Это заявление находится в полном согласии с гипотезой о разумном замысле.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 13:32:42
Это заявление находится в полном согласии с гипотезой о разумном замысле.
Замысел и цель семантически сочетаемы без гипотез.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 13:48:21
Принимая во внимание исключительно низкую вероятность, которую мы наблюдаем в живых организмах, случай решением быть не может, и ни один здравомыслящий биолог никогда этого не заявлял. (Докинз).
Знаете для кого делаются учеными заявление что на Марсе, Титане или Венере возможна жизнь, для неграмотных лохов налогоплательщиков, с которых умные учёные хотят снять деньги на свои рутинные исследования. Здравомыслящий биолог Докинз этим и занимается на публике. Все его научно-популярные заявления направлены на публику налогоплательщиков. В учёном сообществе здравомыслящий биолог  такого не заявить в своей научной работе, потому как учёные колеги быстро ему докажут что он дурень. Все нездравомыслящие биологи типа Докинза заявляют дурь для неграмотной публики налогоплательщиков. ясно что случайные мутации идут с низкой скоростью и спонтанно, всё зависит от условий среды и её открытости по отношению к внешним воздействиям. Сейчас на венере обнаружили признаки жизни, ещё один повод состричь с налогоплательщика денег на рутинные исследования.     
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 13:55:11
Знаете для кого делаются учеными заявление что на Марсе, Титане или Венере возможна жизнь, для неграмотных лохов налогоплательщиков, с которых умные учёные хотят снять деньги на свои рутинные исследования. Здравомыслящий биолог Докинз этим и занимается на публике. Все его научно-популярные заявления направлены на публику налогоплательщиков. В учёном сообществе здравомыслящий биолог  такого не заявить в своей научной работе, потому как учёные колеги быстро ему докажут что он дурень. Все нездравомыслящие биологи типа Докинза заявляют дурь для неграмотной публики налогоплательщиков. ясно что случайные мутации идут с низкой скоростью и спонтанно, всё зависит от условий среды и её открытости по отношению к внешним воздействиям. Сейчас на венере обнаружили признаки жизни, ещё один повод состричь с налогоплательщика денег на рутинные исследования.   
Несколько раз перечитал. Правильно ли я понял, что здравомыслящие биологи верят в Божий разумный замысел?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 14:26:58
Извините, не понял, что вы про абиогенез. Про абиогенез Докинз рассуждает в параграфе "Антропный принцип: планетарный вариант" 4-й главы.

Жизни нужно было зародиться лишь однажды. Поэтому мы вправе допустить, что её появление было крайне маловероятным событием, на много порядков менее вероятным, как будет показано, чем полагает большинство людей. Но последовавшие за этим эволюционные шаги повторяются более или менее похожим образом в каждом из миллионов и миллионов видов и, что немаловажно, сходным образом и непрерывно на протяжении геологического времени. Поэтому для объяснения эволюции сложных жизненных форм нельзя использовать те же статистические подходы, которые мы вправе применить к событию зарождения жизни. Составляющие непосредственный ход эволюции события не могут быть такими же маловероятными (возможно, за редкими исключениями), как единичный факт зарождения жизни. "Антропный принцип: планетарный вариант"

Ну для лохов налогоплательщиков всё это.
Альтернативная, антропная, гипотеза, подобно обсуждению зон Златовласки, опять базируется на статистике. Учёные привлекают чудесные свойства очень больших чисел. Подсчитано, что в нашей Галактике существует от 1 до 30 миллиардов планет, а во Вселенной — около 100 миллиардов галактик. Отбросив для большей строгости подсчётов несколько нулей, получим заниженное количество планет во Вселенной — миллиард миллиардов 1018. Теперь представим, что зарождение жизни — самопроизвольное возникновение молекулы, аналогичной ДНК, — действительно представляет собой исключительно маловероятное событие. Представим, что оно настолько маловероятно, что может произойти только на одной планете из миллиарда. Если бы любой химик попытался получить грант на исследование с однопроцентным шансом на успех, субсидирующая организация подняла бы его на смех. А мы ведём речь об одном шансе из миллиарда. И тем не менее, несмотря на абсурдно малую долю вероятности, она означает, что жизнь возникнет на миллиарде планет, одна из которых, конечно, — наша Земля.*

Поразительный вывод. Повторю его ещё раз. Если даже шансы самопроизвольного зарождения жизни на планете составляют один к миллиарду, это исключительно маловероятное событие тем не менее произойдёт на миллиарде планет. Попытки отыскать в таком количестве планет обитаемую подобны попыткам найти иголку в стоге сена. Но нам не придётся ворошить стог в поисках иголки, потому что (возвращаясь к антропному принципу) ещё до начала поиска любое способное к поиску существо уже должно иметь под собой одну из этих исключительно редких «иголок»."Антропный принцип: планетарный вариант"


Для неграмотных лохов американских налогоплательщиков такие рассуждения Если даже шансы самопроизвольного зарождения жизни на планете составляют один к миллиарду, это исключительно маловероятное событие тем не менее произойдёт на миллиарде планет. Вероятность случайного возникновения полипептидной цепи фермента carboxypeptidase  длинной в 300 аминокислот  равна (1/20)300 или  2,04*10-390, где тут шансы самопроизвольного зарождения жизни на планете составляют один к миллиарду? для лохов всё это.В ограниченном пространстве протоклетки под защитой липидной мембраны нужно в одно время создать 61 полипептидную цепь фермента- синтезы как минимум  и паралельно записать их в последовательность 61 генов как минимум на ДНК.
(http://childrenscience.ru/legacy/genetics/images/gen0301_2x.png)

Терминатор – нетранскрибируемый участок ДНК в конце гена, на котором останавливается синтез РНК.(https://myslide.ru/documents_3/bab03bf874a6188d91819bec68d607ba/img9.jpg)
я это к тому что для кодирования на ДНК одного фермента нужна куда большая полинуклеотидная последовательность нуклеотидов чем число кодируемых ими аминокислот фермента. терминатор это 31 дополнительный неслучайный нуклеотид.
А сколько еще особенных последовательностей нуклеотидов неслучайны в ДНК.
ЦИСТРОН –последовательность нуклеотидов, кодирующих один продукт (мРНК , рРНК или tРНК)
ГЕН – единица транскрипции эукариот
ОПЕРОН – единица транскрипции прокариот
ПРОМОТОР - особая последовательность нуклеотидов ДНК, узнаваемая РНК-полимеразой как посадочная площадка и старт синтеза РНК
ТЕРМИНАТОР - особая последовательность нуклеотидов
ДНК, узнаваемая РНК-полимеразой как финиш транскрипции
ЭКЗОН – транскрибируемый и транслируемый участок гена эукариот
ИНТРОН – транскрибируемый, но не транслируемый участок гена эукариот
ЭНХАНСЕРЫ – последовательности нуклеотидов ДНК, которые усиливают транскрипцию
САЙЛЕНСОРЫ - последовательности нуклеотидов ДНК, которые ослабляют транскрипцию
 
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 14:51:23
Для неграмотных лохов американских налогоплательщиков такие рассуждения Если даже шансы самопроизвольного зарождения жизни на планете составляют один к миллиарду, это исключительно маловероятное событие тем не менее произойдёт на миллиарде планет. Вероятность случайного возникновения полипептидной цепи фермента carboxypeptidase  длинной в 300 аминокислот  равна (1/20)300 или  2,04*10-390, где тут шансы самопроизвольного зарождения жизни на планете составляют один к миллиарду? для лохов всё это.
Он ещё про мультивселенную рассказывал (в следующем параграфе). Если миллиарда планет мало для случайного возникновения жизни, может быть неизвестное количество вселенных. Суть в том, что неправильно использовать Бога как затычку. https://ru.wikipedia.org/wiki/Бог_белых_пятен
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 15:09:32
Несколько раз перечитал. Правильно ли я понял, что здравомыслящие биологи верят в Божий разумный замысел?
Кто то верит, но этим не оперирует в публикациях, кто то помалкивает. Веру к фактам не пришьёшь. Вера в Бога эта нравственная сторона жизни человека, а есть еще и безнравственная, кому как удобно жить.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 15:11:32
Он ещё про мультивселенную рассказывал (в следующем параграфе). Если миллиарда планет мало для случайного возникновения жизни, может быть неизвестное количество вселенных. Суть в том, что неправильно использовать Бога как затычку. https://ru.wikipedia.org/wiki/Бог_белых_пятен

ну это из разряда веры в бесконечную вселенную и бесконечную энергию или пантеизм, природа безличный бог. Почему такого безличного бесконечного бога природу можно использовать как затычку белых пятен? Этот разводила неграмотных хохов американских налогоплательщиков занимается не наукой, а научным атеизмом, находится в идейном противостоянии разумному замыслу или научному антиатеизму. 
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 19.09.2020, 15:20:43
Замысел и цель семантически сочетаемы без гипотез.
Замысел где возникает?
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 15:25:19
Замысел где возникает?
В интеллекте.
Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 19.09.2020, 16:02:11
В интеллекте.
Видите, как замечательно? )
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 16:28:59
В интеллекте.
(https://elementy.ru/images/news/heterotrophic_protocell_model_600.jpg)
вот модель протоклетки, липидная мембрана, внутри которой собраны все необходимые для сборки молекулы. Так как нет механизма фильтрации по хиральной чистоте, то предположительно  смесь должна быть хирально грязной, а жизнь формируется в хирально стиральной среде. поэтому под мембраной должны быть все L- и D- изомеры молекул. 40 аминокислот и 10 нуклеотидов. Считать вероятности формирования полипептидных и полинуклеотидных последовательностей нужно по формуле P(ACGT)=P(A)P(C)P(G)P(T). Если события  протекают паралельно, одновременно собираются несколько полипептидных цепей белков ферментов, то вероятности сборки каждого отдельного фермента складываются. так мы можем посчитать вероятность следуя некой технологической карте сборки от простого к сложному. Нам не нужно точно знать вероятность возникновения одной первой клетки, нам достаточно иметь представление о каких числах идет речь. Потом мы можем заняться моделированием модернизации простой клетки, внедряя в неё индуцированные разумом мутации, то есть начать редактировать простой программный код(генетическую программу) и получать хорошие результаты. мы можем посчитать вероятность случайных возникновений хороших вставок, и так довести редактирование от простого к сложному до ДНК человека, посчитать вероятность того как собранные под липидной мембраной хирально грязные смеси молекул эволюционировали случайным образом до человека. В хирально грязной среде протоклетки Вероятность случайного возникновения полипептидной цепи фермента carboxypeptidase  длинной в хирально чистых 300 аминокислот  равна (1/40)300, где аминокислотные 20L-изомеры + 20D-изомеры = 40.
           
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 16:29:21
Видите, как замечательно? )
Неплохо.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 16:44:50
программный код(генетическую программу)
Нет никакого генетического кода. Собственно, из-за этого я стал писать в этой теме. Бог не Бог - это уже какие вбоквелы пошли. По вопросу лучше всех высказался Сергей_54, предложив поменять микропрограмму в митохондриях (или где там). Код не участвует в микропрограмме, которую он обозначает, информация ДНК в синтезе белка участвует, поэтому информация ДНК не код.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 16:59:06
Нет никакого генетического кода. Собственно, из-за этого я стал писать в этой теме. Бог не Бог - это уже какие вбоквелы пошли. По вопросу лучше всех высказался Сергей_54, предложив поменять микропрограмму в митохондриях (или где там). Код не участвует в микропрограмме, которую он обозначает, информация ДНК в синтезе белка участвует, поэтому информация ДНК не код.

Программный код программы — это текст, выполненный на особом языке, понятном машине. Он может выполняться непосредственно по тексту с помощью интерпретатора или транслироваться в особый вид с помощью компилятора.

Сдались вам эти придирки к общим понятиям.
ДНК глазами программиста (https://habr.com/ru/post/410103/)

Вот что я понимаю под генетическим кодом и не надо его впихивать в ваш компьютер.
(http://900igr.net/up/datas/77089/012.jpg)
Как он работает я вам тоже показал, как он будет работать на вашем компьютере я вам не говорил, не будет он работать, так зачем сравнивать то что несовместимо. Кодируемую последовательность ДНК я называю программным кодом или программой в том контексте, который я вам раскрыл репликация транскрипция и трансляция ген ДНК  -> мРНК ->белок. компьютерную дискуссию я не навязывал, общие понятия должны пониматься в контексте, ане переносится из другой области компьютерного программирования.     
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 17:27:53
Программный код программы — это текст, выполненный на особом языке, понятном машине. Он может выполняться непосредственно по тексту с помощью интерпретатора или транслироваться в особый вид с помощью компилятора.
Да. Зачем вы это написали?
Цитировать
Сдались вам эти придирки к общим понятиям.
Верующие в коде видят руку Бога: код для компьютеров сочиняют программисты, а код для живых существ сочинил Бог. Это заблуждение. Где заблуждение - там нет истины. Где нет истины - там нет Христа. Где нет Христа - там погибель. Где погибель - там плохо. Чисто сострадание.

Цитировать
ДНК глазами программиста (https://habr.com/ru/post/410103/)
Некоторые программисты не понимают, что такое код.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 17:37:59
Критерии искусственности объекта я вам показал Михай Вадимович, но вы мне Докинза в тиснули.
Критерии искусственности клетки, вокруг этого все мои картинки, в том что под липидной мембраной протоклетки чтобы заработал механизм самовоспроизводящегося автомата, нужно сначала в процессе абиогенеза создать работоспособные третичные и четверичные структуры белков и РНК в материале и одновременно весь этот созданный физический материал молекулярных машин и механизмов в генетическую информацию котируемых на ДНК генов. Без работоспособных третичных и четверичных структур белков и РНК в материале ДНК бесполезная последовательность нуклеотидов. Без ДНК работоспособные третичные и четверичные структуры белков и РНК в материале умерли, отжив свой единственный короткий век, не дав потомства-копий.     
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 17:46:12
Код не участвует в микропрограмме, которую он обозначает,
??
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 17:56:02
нуклеотид не есть смысловая единица кода, смысловая единица кодон это триплет состоящий полинуклеотидной цепи из трех нуклеотидов. кадони кодирует аминокислоту или знак препинания, что подтверждается систематической проверкой.

Хорошо, будем читать кодон. Систематическая проверка в данном случае показывает лишь очевидный факт постоянства химических свойств кодона, ничего более.
Цитировать
эта таблица экспериментально подтверждена.
если их можно систематически проверять, то есть подвергнуть проверкам, результатом чего может быть их опровержение.
Так и? Что эта таблица доказывает? Кодон имеет определенные химические свойства и вступает в реакции, результатом которых является в том числе и синтез определенной аминокислоты. Свойства эти постоянны, что подтверждают проверки. Очень хорошо.

Но вопрос-то был, как вы предлагаете фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
Вопрос понятен? Иначе говоря, как можно вашу гипотезу опровергнуть?
Цитировать
опять не нуклеотид, а треплет-кодон внизу в таблице, где аминокислоту не кодируют только стоп-кодоны, голубым выделены. И у них есть функциональный смысл. 
все это систематически проверено экспериментом.
Вы опять путаете свойства и смысл.
Цитировать
Термин информация навязываете вы
Я? Вообще-то, это вы пишите о буквах, языке, коде, полагаете тут можно обойтись без информации? :)
Цитировать
Какие вы тут хотите абстракции и информации мне втюхать?
Чрезвычайно верное замечание, только втюхать хотите именно вы. Лично я, никаких абстракций и информации здесь не вижу. А следовательно ни о каких кодах (система условных обозначений) мы говорить не можем.
Цитировать
так настаивайте, кто вам запрещает, только я то ту причем, об "абстрактные правилах" говорите вы тут, я о транскрипции и трансляции, а это экспериментально подтвержденные механизмы перевода генетической информации в функциональный смысл белка и РНК.
Как это? Любой код это и есть система условных (абстрактных) правил. У нас ничего подобного нет, только лютое следование законам химии.
 
Цитировать
зачем мне вашей голове условные знаки искать. есть генетический код и механизмы его декорирования прочтения и перевода в иной функциональный смысл, в белок и РНК.
Затем, что бы хоть чем-то подкрепить утверждение, что ДНК это код (система условных знаков). А какой же это код, если условных знаков вы предъявить не можете?

Цитировать
Я вам про Януса Полуэктовича, а вы мне прор Выбегалло. я вам достаточно пояснил суть генетического кода, а вы мне про СС+. и АЛДАН.
Суть вы изложили прекрасно. Правда ничего из этой сути не подтверждает ваши утверждения.
Увы.

И что там с еще одним моим вопросом?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 18:02:39
Да. Зачем вы это написали?
так для всякого, тут про коды пишут.
Цитировать
Верующие в коде видят руку Бога: код для компьютеров сочиняют программисты, а код для живых существ сочинил Бог. Это заблуждение. Где заблуждение - там нет истины. Где нет истины - там нет Христа. Где нет Христа - там погибель. Где погибель - там плохо. Чисто сострадание.
остается только доказать что то что вы написали есть Истина.

 Что заблуждение что код для компьютеров сочиняют программисты? Или Бог сотворивший живые существа творец и кода для живых существ?
Это генетический код:
(https://cf2.ppt-online.org/files2/slide/g/gkXjqtwRb6x4WNK2eCPzTmyFM3flSaOH1iGEsnDUpV/slide-31.jpg)
а как он синтезируется ферментами-синтезами я вам показал, Бог сотворил 61 специальную фермент-синтезу и связал тРНК с её персональным антикодоном с определенной аминокислотой, а антикодон тРНК комплементарной связан с соответствующим комплементарным кодоном матричной мРНК, а следовательно и ДНК. Говоря о Боге, я подразумеваю Разум с большой буквы, видя разумное в ДНК своим маленьким разумом, вижу руку большого Разума, потому как во время абиогенеза маленького разума не существовала, он был только в проекте ДНК. Бог создал из сотворенной энергии материю, атомы молекулы, из них создал жизнь. Использовал правильно и разумно естественные химические реакции, так как Он есть причина феномена законов природы.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 18:04:29
Ни как не отличить. Информация видна не на самом носителе, а на выходе - что в итоге получается. Или смотрим на наличие механизма декодирования, если он есть, то это программа.
Так, что бы в итоге не получилось, оно получится в строгом соответствии с законами химии. Получается, вы по собственному произволу решаете какой результат осмыслен, а какой нет. А проверить это никак нельзя.
И, вот это большой минус вашей гипотезе, отсутствие возможности проверки (критерий научности).
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 18:26:29
Так, что бы в итоге не получилось, оно получится в строгом соответствии с законами химии. Получается, вы по собственному произволу решаете какой результат осмыслен, а какой нет. А проверить это никак нельзя.
И, вот это большой минус вашей гипотезе, отсутствие возможности проверки (критерий научности).
автомобиль это сплошные законы физики и химии упорядывающие состояние и движение материи, но его можно записать виде программы используя 0 и 1, вложить компьютер, который управляет всеми процессами производства автомобиля. Как проверить, что автомобиль создан разумом, а не только законами физики и химии? 0 и 1 это тоже физические явления в транзисторе, прохождение или запирание электрического тока, у лампы есть анод, катод и сетка управляющая проходимостью тока зарядов от анода к катоду. это всё физические инструменты и  законы действуют, но код 0 и 1 может записать последовательность операций по производству автомобиля. проблема вот только в том как проверить участие внешнего разума в полностью автоматизированном процессе полного замкнутого цыкал производства автомобиля? 
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 18:36:07
Вы не внимательно читали - перфолента без информации, это  лента со случайными дырками. Эти две перфоленты друг от друга не отличишь. Точно так же как и ДНК полученную в пробирке со случайным порядком нуклеотидов от ДНК кодирующее ваши уши.
Перфолента без условных знаков это перфолента без дырок, как выглядит ДНК без условных знаков??
Цитировать
Семантику и грамматику учёные нашли в коде ДНК:
ГЕНОМ КАК ИНФОРМАЦИОННО-СЕМИОТИЧЕСКИЙ ФЕНОМЕН https://cyberleninka.ru/article/n/genom-kak-informatsionno-semioticheskiy-fenomen   /Золян С.Т. - д.ф.н. проф., Жданов Р.И. - д.х.н. проф./
Генетический язык: алфавиты, слова и семантика. /Тимофеев А.В. — д.т.н., проф./ саму работу загуглите
Я вам показал, что вы просили - наличие семантики в генах. Теперь по правилам жанра вы должны поменять свою точку зрения?
Нет, вы показали, именно то о чем я говорил, для понимания и объяснения суперсложных процессов, происходящих с ДНК применяются аналогии.
Аналогия эта подходит, но это совершенно не значит, что ДНК действительно является информационно-семиотическим феноменом. Обратите внимание на слово "как" в названии статьи.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 18:40:37
Так аналогия правильно описывает суперсложную ситуацию? Если не правильно, то приведите научную статью, где сказано, что ген.код - это на сам деле не код, что ген.алфавит - это не алфавит, и.т.п.
Аналогия подходит, пользоваться ей можно, но это совершенно не значит, что ДНК содержит какую-то семантику. Подтверждением было бы, если бы вы показали эту семантику непосредственно в ДНК, а так, мало ли что на что похоже...

А, утверждение делаете вы, вам его и доказывать. :)
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 18:45:27
Перфолента без условных знаков это перфолента без дырок, как выглядит ДНК без условных знаков??
Теломеры.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 18:54:52
??
Код компьютерной команды служит чисто для указания микропрограммы, которая выполняется по этому коду устройством управления процессора. Выполнение микропрограммы и её результат не зависят от того, каким кодом она вызвана.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 18:57:53
У электрона, так же как у ложки, кастрюли, компьютера, машины и.т.п. есть свои задачи, которые они реализуют от своих свойств-функций. Свойства-функции этих объектов определяют их целесообразность, цель и смысл их существования
Не важно, имеет муха сознании или нет - если что-то ей необходимо для существования, то это и имеет в себе цель и смысл существования. Если допустим, пот человека крайне необходим мухе (например какие-то важные для неё витамины/элементы), то помимо терморегуляции он будет ещё иметь цель подкармливать муху необходимым.  Точно так же яблоко на дереве, помимо цели размножения, имеет в себе цель подкармливать человека витаминами. Тогда можно сказать, что пот человека для мухи это то же самое, что яблоки на дереве для человека.
О как интересно, то есть любое свойство или функция это и будет цель. Но, это легко опровергнуть. Создатели стеклянных бутылок не имели своей целью, что бы хулиганы кололи людей "розочками", создатели автомобилей не имели своей целью, что бы бомжи спали в них на свалках, а маньяки давили ими людей, хотя функции такие эти предметы имеют.

Как видите равнять функцию и цель, ни в коем случае нельзя.

Цитировать
И почему вы находитесь в голове именно Модеста Матвеевича, а не И.Соколова? У меня ведь тоже есть нейроны. Вы не ответили на этот вопрос.
Ответил. Не хотите же вы сказать, что у нас с вами в головах одинаковые нейроны? Не бывает двух одинаковых людей.

Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 19:00:49
Код компьютерной команды служит чисто для указания микропрограммы, которая выполняется по этому коду устройством управления процессора. Выполнение микропрограммы и её результат не зависят от того, каким кодом она вызвана.
Вы при машинный код? Разумеется, зависят.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 19:04:23
Печатные пятна в книге состоят из молекул краски. Отражённый от них свет воспринивается светочувствительными молекулами, разновидность пятна определяет совокупность многих молекул, из которых состоит мозг или компутер. Никакой семантики. Увы.
И кто из нас вульгарный материалист? :)
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 19:07:08
И кто из нас вульгарный материалист? :)
Таки это был пересказ Вашего рассуждения применительно к другому примеру.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 19:13:57
Вы при машинный код? Разумеется, зависят.
??
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 19:14:47
А как вы узнаете, что они искусственные, если ничего не знаете о цивилизации, построившей такой завод? Лем, например, моделировал такие ситуации в романе "Эдем". Вот, вроде бы завод. Да, механизмы, конвейеры... Но делает невесть что и непонятно зачем. А может, это вовсе не завод, а живой организм? Или роман Кларка "Свидание с Рамой". Там целый город-завод внутри космического корабля, построенный вроде бы... разумными раманами. Производит роботов. Но со временем возникает подозрение, что эти роботы и есть рамане, и что никаких других раман не существует.
Разумеется, если исходить из предположения, что создатели завода подобны человеку, то тогда, да, их изделия удастся идентифицировать как искусственные. Но это наиболее дурацкое из возможных предположений, учитывая разнообразие Вселенной. Оно уместно только для язычников, создававших богов по своему образу и подобию - чему, разумеется, сии боги охотно "подыгрывали".
Александр52 имел ввиду как раз такие заводы про которые точно известно, что они искусственные.
Цитировать
См. мой предыдущий комментарий. "Очевидно" это лишь человеку, а не марсианину. А болты и гайки - просто признак крайнего несовершенства технологии. Со временем даже наша технология, очевидно, научится конструировать приборы на микроуровне молекулярных связей, и никаких грубых следов производства вроде "болтов и гаек" там уже не будет. Разве что шутки ради.
Вспомните монолит из "Одиссеи-2001". Да, технология, причем очень совершенная. Настолько совершенная, что во второй части такие монолиты превращают Юпитер в звезду. Но внешне это просто параллелепипед! Да, он непохож на обычные камни, кристаллов такой формы не бывает. Но и ДНК непохожа на молекулу воды.
Вообще-то, чем больше развивается цивилизация, тем больше оставляет следов. К первым каменным рубилам нужно очень тщательно присматриваться, точно ли это орудие или естественный скол. А, вот дредноут или орбитальный челнок таких вопросов не вызывает от слова совсем.

А придумать можно все, что угодно, особенно, если ты писатель-фантаст.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 19:18:23
??
На любом конкретном устройстве конкретные действия вызывает конкретная кодовая последовательность.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 19:25:52
На любом конкретном устройстве конкретные действия вызывает конкретная кодовая последовательность.
И?
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 19:28:13
И?
А Вы пишете, что результат от кода не зависит. Достаточно изменить в коде один бит, и результат будет другим. Как же не зависит?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 19:32:14

Хорошо, будем читать кодон. Систематическая проверка в данном случае показывает лишь очевидный факт постоянства химических свойств кодона, ничего более.Так и? Что эта таблица доказывает? Кодон имеет определенные химические свойства и вступает в реакции, результатом которых является в том числе и синтез определенной аминокислоты. Свойства эти постоянны, что подтверждают проверки. Очень хорошо.
Согласен

Цитировать
Но вопрос-то был, как вы предлагаете фальсифицировать ваше утверждение о наличии в нуклеотиде информации, заложенной туда для последующей передачи?
Единица информации в последовательности трех нуклеотидов.


Цитировать
Вопрос понятен? Иначе говоря, как можно вашу гипотезу опровергнуть?
нуклеотид не кодирует аминокислоту.

Цитировать
Вы опять путаете свойства и смысл.
Я употребляю понятие функциональный смысл.


Цитировать
Я? Вообще-то, это вы пишите о буквах, языке, коде, полагаете тут можно обойтись без информации? :)
аналогия с русским языком. но это не русский язык, а ДНК это не книга.

Цитировать
Чрезвычайно верное замечание, только втюхать хотите именно вы. Лично я, никаких абстракций и информации здесь не вижу. А следовательно ни о каких кодах (система условных обозначений) мы говорить не можем.Как это? Любой код это и есть система условных (абстрактных) правил. У нас ничего подобного нет, только лютое следование законам химии.
работа транзистора или триода это управление прохождения электрического сигнала, где вытам видели 0 или 1?
(https://upload.wikimedia.org/wikipedia/commons/thumb/0/0f/6SN7russ.JPG/548px-6SN7russ.JPG)

 
Цитировать
Затем, что бы хоть чем-то подкрепить утверждение, что ДНК это код (система условных знаков). А какой же это код, если условных знаков вы предъявить не можете?
что вы понимаете под условным знаком? Кодон АУГ кодирует аминокислоту метионин. условность означает (у)слова, нечто, что наделяет слово смыслом. мы произносим физические звуки складываем в фонемы и соотносим их к мысли и внешнему предмету, называем это словом записанным гласными и согласными символами кодами. Мы к слову-коду привязали мысль и внешний предмет. Некоторые говорят что наши мысли это биохимические процессы в нейронных сетях мозга. Электро-химические возбуждения некоторых участков нейронной сети головного мозга.
Если кодон генетическое слово, то и у него должно быть (у)слово, что то вроде бы нейронной сети ответственной за мысль и привязку к ней внешнего предмета аминокислоты. то есть условность делающая кодон кодом. Бог творит условность, в моей интерпретации, случай и законы физики и химии в вашей 61 фермент-синтезы. Ферменты это белки,полипептидные последовательности, которые благодаря особой строго предопределенной замыслом последовательности аминокислот первичной структуры белка, определяется пространственная третичная и четверичная структура фермента-синтезы, где во внутреннем пространстве третичной структуры возникают три зоны, куда может встраиваться аминокислота, АТФ и тРНК. При чем для каждой из 61 фермента синтезы пространство для встраивания тРНК имеет объемную геометрию строго подходящую только для одной из 61 тРНК, которая имеет свой личный отличительный знак триплет антикодон, и свою индивидуальную третичную структуру, то есть для каждой тРНК своя персональная фермент-синтеза. Другая пространственная область внутри фермента-синтезы, куда встраивается аминокислота на 61-й фермете-синтезе имеет 20 форм, строго под каждую из 20 аминокислот. каждая аминокислота отличается друг от друга радикалом, поэтому пространственная геометрия расположения атомов в молекуле разная, поэтому под каждую форму своя третичная структура фермента, предопределенная последовательностью аминокислот первичной структуры. АТФ у вех общая. вырожденность кода предопределена тем что на 61 кодон только 20 аминокислот, и часть тРНК кодируют одну и туже аминокислоту, хотя антикодон разный. фермент-синтеза и есть условность, заложенная при абиогенезе ферментов-синтез. случайно возникли или неслучайно возникли ферменты синтезы это к теории вероятности и законам физики, и конечно к человеку разумному.         

Цитировать
Суть вы изложили прекрасно. Правда ничего из этой сути не подтверждает ваши утверждения.
Увы.

И что там с еще одним моим вопросом?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?
целенаправленность последовательность и результативность. Вероятность результата 1. Шаги все прописаны, идем к цели если не возникают по пути не предвиденные ошибки.   
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 19:33:35
Дорогой Даниэль, популярные сведения я выделил цветом, их можете пропустить, мне нужно было показать, что кроме ДНК последовательности есть ещё необходимые условия, которые должны быть созданы при абиогенезе паралельно с созданием ДНК, чтобы программный код, закодированный полинуклеотидной ДНК-последовательности обрёл смысл программы.  А признак искусственности заключается в том что инженер создавший необходимые параллельные условия, в процессе создания ДНК внес их туда в виде программы-генов, кодирующих все эти необходимые условия - ферменты и РНК. Мой пост выделен обычным черным цветом. Ферменты и РНК при абиогенезе создавались отдельно от ДНК, но вся оних информация по воспроизводству этих ферментов и РНК была включена в ДНК. это признак неслучайности, а разумности.
А ученые полагают иначе. Белковый синтез и генетический код являются результатом постепенной эволюции.

Большинство вспомогательных молекул белкового синтеза изначально имели другие функции и могли возникнуть раньше, чем рибосомы.

Изучение структуры рибосомной РНК (рРНК) показало, что она могла быть построена постепенно, путем добавления новых доменов.

Адаптивным, был и переход от простого регулярного чередования нескольких аминокислот к сложным последовательностям пептидов, для чего пригодился матричный синтез — так появились мРНК, тРНК и генетический код.
Происхождение белкового синтеза и генетического кода (https://istina.msu.ru/media/publications/article/13d/fbb/7360574/2013_07_20-23.pdf)

Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 19:41:53
А Вы пишете, что результат от кода не зависит. Достаточно изменить в коде один бит, и результат будет другим. Как же не зависит?
Я говорил по коды команд, поступающие в устройство управления. Каждой такому коду соответствует микропрограмма, выполняемая этим устройством. Это соответствие условно: выполнение микропрограммы и её результат не зависят от того, каким именно кодом вызвана данная микропрограмма на выполнение. Она может быть вызвана кодом 0 или кодом 99999 - разницы никакой не будет.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 19:43:50
Для неграмотных лохов американских налогоплательщиков такие рассуждения Если даже шансы самопроизвольного зарождения жизни на планете составляют один к миллиарду, это исключительно маловероятное событие тем не менее произойдёт на миллиарде планет. Вероятность случайного возникновения полипептидной цепи фермента carboxypeptidase  длинной в 300 аминокислот  равна (1/20)300 или  2,04*10-390, где тут шансы самопроизвольного зарождения жизни на планете составляют один к миллиарду? для лохов всё это.В ограниченном пространстве протоклетки под защитой липидной мембраны нужно в одно время создать 61 полипептидную цепь фермента- синтезы как минимум  и паралельно записать их в последовательность 61 генов как минимум на ДНК.
В это месте предлагается взять Александра52 за пуговицу и спросить его: "какое отношение имеет упомянутый фермент к возникновению жизни? Он, что необходимое условие появление жизни?"

Никакого отношения этот фермент к абиогенезу не имеет, Александр52 снова мухлюет.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 19:51:37
автомобиль это сплошные законы физики и химии упорядывающие состояние и движение материи, но его можно записать виде программы используя 0 и 1, вложить компьютер, который управляет всеми процессами производства автомобиля. Как проверить, что автомобиль создан разумом, а не только законами физики и химии?

Я уже отвечал вам на этот вопрос. Такой завод, как и автомобиль будет содержать тьму элементов, которые невозможно будет идентифицировать иначе чем искусственные. Не понадобится искать в нем какой-то семантический код, и так все будет ясно.

А с ДНК, как раз все не ясно. И ваш тезис - ДНК искусственное, так как содержит семантические коды.
Только семантику вы эту показать не можете. 


Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 19:53:44
Теломеры.
Там те же самые буквы-кодоны.
Вы не знали?:D
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 20:14:20
Я говорил по коды команд, поступающие в устройство управления. Каждой такому коду соответствует микропрограмма, выполняемая этим устройством. Это соответствие условно: выполнение микропрограммы и её результат не зависят от того, каким именно кодом вызвана данная микропрограмма на выполнение. Она может быть вызвана кодом 0 или кодом 99999 - разницы никакой не будет.
Но в реальности другим кодом будет вызываться другая команда. и если Вы замените команду, результат будет другим. Процессор не поймёт, что под 99999 Вы имели в виду 0.

Можно спроектировать другое устройство, похожее на первое или с изоморфной системой команд, делающее то же самое, где используются другие коды. Но это будет другое устройство.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 20:35:07
Но в реальности другим кодом будет вызываться другая команда. и если Вы замените команду, результат будет другим. Процессор не поймёт, что под 99999 Вы имели в виду 0.

Можно спроектировать другое устройство, похожее на первое или с изоморфной системой команд, делающее то же самое, где используются другие коды. Но это будет другое устройство.
Всё верно. Однако одна и та же микрокоманда может на данном конкретном устройстве может соответствовать и коду 0, и коду 999999 - разницы в выполнении не будет. А в синтезе белка информация днк участвует не условно, для одинакового синтеза по двум разным ДНК процесс должен эту разницу учитывать.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 20:43:38
Всё верно. Однако одна и та же микрокоманда может на данном конкретном устройстве может соответствовать и коду 0, и коду 999999 - разницы в выполнении не будет. А в синтезе белка информация днк участвует не условно, для одинакового синтеза по двум разным ДНК процесс должен эту разницу учитывать.
В частном случае может.

Но так же и с днк: разные триплеты могут кодировать одинаковые аминокислоты.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 20:48:20
А ученые полагают иначе. Белковый синтез и генетический код являются результатом постепенной эволюции.
вероятность возникновения белка в луже меньше чем вероятность возникновения этого белка в галактике Андромеда, там луж побольше. Один удачный фермент возникнет в лужена одной планете, второй на другой и неважно что между ними тысячи световых лет. лужа конечно не галактика андромеда,но для молекул она малое Магелланово облако. Чтобы локализовать белковый синтез и синтез РНК, АТФ для возникновения генетического кода нужно чтобы эти процессы проходили в пробирке протоклетки, под защитной допустим липидной мембраной во внутреннем пространстве,нужно внутри собирать все необходимые ферменты-синтезы РНК и АТФ. что толку будет что один фермент соберется в луже в Африке, другой на планете в созвездии Кассиопея. Все они должны быть локализованы а пространстве протоклетки. конечно таких протоклеток может быть очень много если считать по пальцам,но недостаточно чтобы перекрыть низкую вероятность. Генетический код должен был создан внутри одной протоклетке со всеми АТФ, ферментами-синтезами и тРНК и как то записаться гены ферментов и РНК на ДНК, только так можно единожды удачный вариант ферментов и РНК сохранить для потомков,но для этого в протоклетки должны возникнуть все необходимые молекулярные механизмы транскрипции и трансляции невесть кем закодированных в генах удачные варианты ферментов и РНК.       

Цитировать
Большинство вспомогательных молекул белкового синтеза изначально имели другие функции и могли возникнуть раньше, чем рибосомы.
Каталитические функции белка предопределены спецификой последовательности аминокислот в первичной структуре, а определяет каталитические свойства третичная структура белка, которая определена первичной структурой полипептидной последовательности аминокислот. Ребосома это четверичная структура из белковых и рРНК третичных структур. Рибосома должна возникнуть внутри протоклетки вместе с ферментами-синтезами, тРНК и АТФ как минимум, как необходимая часть. поймите в протоклетке должны два параллельных процесса идти это физическое построение механизма транскрипции и трансляции кода и независимый от ферментов процесс их перевода в гены на ДНК. В протоклетке у всех удачных механизмов век короткий,они не могут себя воспроизвести, пока простейшая клетка не заработает как самовоспроизводящийся автомат. и  все это должно возникнуть внутри одной протоклетке. 
Цитировать
Изучение структуры рибосомной РНК (рРНК) показало, что она могла быть построена постепенно, путем добавления новых доменов.
и сколько миллионов лет случайно удачная рибосома могла существовать, пока всё необходимое собралось в одной протоклетке? 

Цитировать
Адаптивным, был и переход от простого регулярного чередования нескольких аминокислот к сложным последовательностям пептидов, для чего пригодился матричный синтез — так появились мРНК, тРНК и генетический код.
Происхождение белкового синтеза и генетического кода (https://istina.msu.ru/media/publications/article/13d/fbb/7360574/2013_07_20-23.pdf)

(https://cf.ppt-online.org/files1/slide/7/7RhWpqGVsv05kZAufnMiwmDFBY6t9QEczI2gorS3X/slide-62.jpg)
(https://cloud.prezentacii.org/19/03/130410/images/screen15.jpg)
Автор статьи предлагает нам научный атеизм в стиле научпопа.«Химия и жизнь», 2013, № 7
Он борется с разумным замыслом, тут науки мало, деклараций много.   
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 21:23:11
В частном случае может.

Но так же и с днк: разные триплеты могут кодировать одинаковые аминокислоты.
Однако разница между такими триплетами не может быть произвольной. Разные коды процессорных команд могут назначаться одной микрокоманде совершенно произвольно.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 21:24:31
Единица информации в последовательности трех нуклеотидов.
Да-да, читайте триплет-кодон.
Цитировать
нуклеотид не кодирует аминокислоту.
Читаем  триплет-кодон.
Цитировать
Я употребляю понятие функциональный смысл.
Это не тоже самое, что цель?
 
Цитировать
аналогия с русским языком. но это не русский язык, а ДНК это не книга.
Браво! Возможно ДНК это не код (система условных знаков)? Возможно ДНК не нужен программист? ;)
Цитировать
работа транзистора или триода это управление прохождения электрического сигнала, где вытам видели 0 или 1?
В случае транзисторов это будет как раз электрический сигнал (напряжение), либо его отсутствие.
Цитировать
что вы понимаете под условным знаком?

Писал много раз.
https://ru.wikipedia.org/wiki/%D0%97%D0%BD%D0%B0%D0%BA
Цитировать
Кодон АУГ кодирует аминокислоту метионин. условность означает (у)слова, нечто, что наделяет слово смыслом. мы произносим физические звуки складываем в фонемы и соотносим их к мысли и внешнему предмету, называем это словом записанным гласными и согласными символами кодами. Мы к слову-коду привязали мысль и внешний предмет. Некоторые говорят что наши мысли это биохимические процессы в нейронных сетях мозга. Электро-химические возбуждения некоторых участков нейронной сети головного мозга.
Не надо мне по стопятьсотому разу  описывать свойства ДНК.
Условные знаки вы показать не можете. Как фальсифицировать собственные утверждения не знаете.

Всё, что я вижу, это набор химических эллементов, называемый нуклеотид, который ведёт себя точно также как и любой другой набор химических эллементов, а имено
без посторонней помощи, только согласно законам физики и химии, которым подчиняются все известные нам наборы химических эллементов, вступает в химические реакции с другими наборами химических эллементов что приводит к результатами обусловленными законами физики и химии.   
Цитировать
целенаправленность последовательность и результативность.   

Тут интересовались про электролиз воды, отвечает всем требованиям кода. :)
Цитировать
Вероятность результата 1.
Вот этим ДНК в отличие от человеческих программ, как раз похвастаться не может.
Писал об этом.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 19.09.2020, 21:40:15
вероятность возникновения белка в луже меньше чем вероятность возникновения этого белка в галактике Андромеда, там луж побольше.
Это будет видно, когда предъявите расчетик. Пока, что одно бла-бла, да и то не очень честное.
Цитировать
Один удачный фермент возникнет в лужена одной планете, второй на другой и неважно что между ними тысячи световых лет. лужа конечно не галактика андромеда,но для молекул она малое Магелланово облако.

Одного фермента, самореплицирующей молекулы или сообщества таких молекул вполне достаточно для запуска дарвиновской эволюции.
Цитировать
Чтобы локализовать белковый синтез и синтез РНК, АТФ для возникновения генетического кода нужно чтобы эти процессы проходили в пробирке протоклетки, под защитной допустим липидной мембраной во внутреннем пространстве,нужно внутри собирать все необходимые ферменты-синтезы РНК и АТФ.

Эти процессы могут происходить например в пористых глинах.

Цитировать
Автор статьи предлагает нам научный атеизм в стиле научпопа.«Химия и жизнь», 2013, № 7
Он борется с разумным замыслом, тут науки мало, деклараций много.   
Итак у нас с одной стороны научные статьи с другой безграмотное бла-бла и веселые картинки.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 19.09.2020, 21:41:01
(https://upload.wikimedia.org/wikipedia/ru/c/c2/Семантический_треугольник.gif)
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 19.09.2020, 21:55:03
Однако разница между такими триплетами не может быть произвольной. Разные коды процессорных команд могут назначаться одной микрокоманде совершенно произвольно.
При конструировании могут. Для готового устройства не могут. Как минимум для этого потребуется заменить прошивку - в случае, если такая возможность конструктивно предусмотена. Если же устройство не допускает перепрограммирования на уровне железа, то вообще нельзя.
Название: Re: Критерии искусственности объекта.
Отправлено: kapiton от 19.09.2020, 22:17:54
"Так учёные программируют ДНК"
Забористые фейк-ньюс ))

Не fake news (несмотря на то, что изначально опубликовано 1 апреля, по совпадению), а полное непонимание сути со стороны тех, кто хочет видеть здесь прямолинейный креационизм.

Разбирающиеся в программировании могут посмотреть, что представляет из себя спецификация Cello. Например, здесь
https://github.com/CIDARLAB/cello

По существу это Verilog (язык описаний аппаратных логических схем) + Eugene (язык описания правил формирования элементов - последовательностей ДНК).

По совокупности получается вспомогательный надстроечный язык (описания, а не программирования), придуманный людьми ради упрощения процесса генерации ДНК последовательностей, которые во-первых, опирались бы на фиксированый небольшой набор некоторых биологических функций-примитивов (с параметрами, передающимися через условия среды в клетке) и, во-вторых, позволяли бы задавать некую последовательную логику по результатам исполнения таких функций.

Да, можно пытаться навязывать клеточным структурам такой способ работы.

Вопрос однако в том, как всё это дело соотносится с жизнью реальных клеток, с теми способами, которыми они на самом деле работают? И тут всплывают принципиальные, непреодолимые отличия, связанные с ограничениями Cello.

Придуманный людьми язык ничего не даёт для углубления понимания - пока ещё очень и очень поверхностного и фрагментарного - того, как природный генетический код работает - или, что принципиально меняет диспозицию, используется/управляется со стороны загадочных пока, но вполне реальных эпигенетических механизмов!

Интересно и показательно, что полученные цепочки при воплощении в жизнь работают как задумано далеко не всегда:

"After that elaboration, the ensemble returned to their theme by testing 52 more complex circuits as composed by Cello. 37 of these worked completely as expected, and 92% of the input-output states across all circuits were correct.

Of course, Cello doesn't work 100% yet, and it can only design circuits for static inputs and outputs. However, as the first real design automation in synthetic biology, it's a huge step forward."

* * *

Вера в прямое и непосредственное программирование генетики неким "инженером свыше" - такая же нелепость, как и вера в чудесное формирование генетических программ естественным отбором из случайных мутаций (если случайно менять код реальных компьютерных программ, то, не говоря даже об исчезающе малой вероятности практических улучшений, никакой отбор не поможет - существенная часть вредных мутаций не будет проявляться явным образом сразу, не будет отсеяна, зато впоследствии даст отложенный кумулятивный эффект - в сочетании с любыми другими мутациями, даже "полезными"; итог - неизбежная гибель всей популяции). Ключ к пониманию биологии в другом - в витальном = в бессознательной жизни, логическое указание на которую надо видеть в современном т.н. "искусственном интеллекте" и машинном обучении, а онтологическое - в описаниях опыта клинической смерти, свидетельствующых о существовании у человека "эфирного" тела - другой материальности, отличной от физической, взаимодействующего с ней (надо ставить физические эксперименты не на ускорителях частиц, а в живых организмах).
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 19.09.2020, 22:32:31
При конструировании могут. Для готового устройства не могут. Как минимум для этого потребуется заменить прошивку - в случае, если такая возможность конструктивно предусмотена. Если же устройство не допускает перепрограммирования на уровне железа, то вообще нельзя.
Такая перепрошивка затронет только соответствие команд и микрокоманд, но не потребует изменения микрокоманд. Синтез белка происходит по определённым правилам. Для того, чтобы произвольный кодон совпадал по аминокислоте с другим кодоном, потребуется изменить правила.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 20.09.2020, 00:23:14
Вера в прямое и непосредственное программирование генетики неким "инженером свыше" - такая же нелепость, как и вера в чудесное формирование генетических программ естественным отбором из случайных мутаций (если случайно менять код реальных компьютерных программ, то, не говоря даже об исчезающе малой вероятности практических улучшений, никакой отбор не поможет - существенная часть вредных мутаций не будет проявляться явным образом сразу, не будет отсеяна, зато впоследствии даст отложенный кумулятивный эффект - в сочетании с любыми другими мутациями, даже "полезными"; итог - неизбежная гибель всей популяции).
Что вы говорите! А в нашей реальности метод мутаций и отбора (генетический метод) дает прекрасные результаты выращивания программ.
Генетическое программирование (https://ru.wikipedia.org/wiki/%D0%93%D0%B5%D0%BD%D0%B5%D1%82%D0%B8%D1%87%D0%B5%D1%81%D0%BA%D0%BE%D0%B5_%D0%BF%D1%80%D0%BE%D0%B3%D1%80%D0%B0%D0%BC%D0%BC%D0%B8%D1%80%D0%BE%D0%B2%D0%B0%D0%BD%D0%B8%D0%B5)
Название: Re: Критерии искусственности объекта.
Отправлено: kapiton от 20.09.2020, 01:29:19
Генетическое программирование - это случайные изменения на ограниченном и очень специфически подобранном поле изменений (которые заведомо ничего не испортят фатально), и отбор вовсе не "естественный", а искусственный, по грамотно продуманному критерию. И то, и другое разумно планируется - так, чтобы зная примерно какого рода программа нужна, подобрать наиболее оптимальную комбинацию её блоков.

Осуществляется в этом деле не вообще абстрактная эволюция в чём только можно, а достигается заранее поставленная цель оптимизации (через хорошо продуманный критерия отбора). Как только цель достигнута, эволюция прекращается! Никакие другие цели сами собой ставиться и достигаться не будут.

Название: Re: Критерии искусственности объекта.
Отправлено: Дмитрий60 от 20.09.2020, 11:44:59
онтологическое - в описаниях опыта клинической смерти, свидетельствующых о существовании у человека "эфирного" тела - другой материальности, отличной от физической, взаимодействующего с ней (надо ставить физические эксперименты не на ускорителях частиц, а в живых организмах).
Привет эзотерикам.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 20.09.2020, 15:00:41
Такая перепрошивка затронет только соответствие команд и микрокоманд, но не потребует изменения микрокоманд.
Если это требуется, надо создавать новое устройство. Ровно так же, как и в случае, когда

Цитировать
Синтез белка происходит по определённым правилам. Для того, чтобы произвольный кодон совпадал по аминокислоте с другим кодоном, потребуется изменить правила.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 20.09.2020, 15:08:08
Александр52 имел ввиду как раз такие заводы про которые точно известно, что они искусственные.
Если это заранее известно, то и вопросов нет. Это мой первый критерий: искусственное = созданное человеком.

Вообще-то, чем больше развивается цивилизация, тем больше оставляет следов. К первым каменным рубилам нужно очень тщательно присматриваться, точно ли это орудие или естественный скол. А, вот дредноут или орбитальный челнок таких вопросов не вызывает от слова совсем.
Это ничего не доказывает. Громоздкие сооружения, переполненные деталями, конечно, резко отличаются от природных феноменов, но ведь громоздкость технологии - просто признак несовершенства и недостатка разума. Еще более показательно взять в качестве примера... городскую свалку. Вот такого в природе точно нет :)

По мере совершенствования лишние детали исчезают. Искусственный глаз (https://news.israelinfo.co.il/health/89501) уже гораздо меньше похож на монструозный дредноут и больше - на биологические механизмы.

Другой пример: колесо. Это древнейшее из известных изобретений, причем одно из самых гениальных. Объясните мне, как, глядя на каменное или деревянное колесо, доказать, что оно искусственное? Если, разумеется, не знать, что есть такой человек, который изобрел колесо. Круглые предметы в природе, да, встречаются.

А придумать можно все, что угодно, особенно, если ты писатель-фантаст.
Если наука рассматривает неизвестное явление, то фантазия не мешает, а помогает. Науке неизвестно, как могла возникнуть ДНК.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 20.09.2020, 15:22:11
Дорогой Даниэль, популярные сведения я выделил цветом, их можете пропустить, мне нужно было показать, что кроме ДНК последовательности есть ещё необходимые условия, которые должны быть созданы при абиогенезе паралельно с созданием ДНК, чтобы программный код, закодированный полинуклеотидной ДНК-последовательности обрёл смысл программы. 
Я о том, что такого рода огромные тексты вызывают отторжение :( Мне интересна биология, но я предпочту читать это в хорошей книге известного автора, а не в виде цитат на богословском (!) форуме.

А признак искусственности заключается в том что инженер создавший необходимые параллельные условия, в процессе создания ДНК внес их туда в виде программы-генов, кодирующих все эти необходимые условия - ферменты и РНК. Мой пост выделен обычным черным цветом. Ферменты и РНК при абиогенезе создавались отдельно от ДНК, но вся оних информация по воспроизводству этих ферментов и РНК была включена в ДНК. это признак неслучайности, а разумности.
Если я верно понимаю, вы ведь верующий человек, православный. Разве вы отрицаете, что Бог создал наш мир, жизнь и человека? Разве вам нужно вмешательство какого-то дополнительного разума, какой-то цивилизации?

Я не отрицаю, что это возможно, более того, имею основания предполагать, что иные цивилизации действительно вмешивались в процесс развития жизни. Но... все же полагаю, что это вторично. Первично творение мира, как оно описано в Библии. И я уверен, что Всемогущий Бог, разумеется, мог направить химическую эволюцию на нашей планете таким образом, чтобы ДНК и РНК образовались совершенно естественным путем, так же, как и все прочее, сотворенное Им. Богу не нужны помощники!
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 20.09.2020, 15:34:26
Такая перепрошивка затронет только соответствие команд и микрокоманд, но не потребует изменения микрокоманд. Синтез белка происходит по определённым правилам. Для того, чтобы произвольный кодон совпадал по аминокислоте с другим кодоном, потребуется изменить правила.
(https://fb.ru/misc/i/gallery/91036/2769434.jpg)
Нуклеотид элементарная знаковая единица генетического кода, триплет кодон последовательность трех нуклеотидов элементарная смысловая единица. полинуклеотидная последовательность ДНК это логически качественно упорядоченная количественная последовательность. При спонтанной сборке (синтезе) количественной последовательности вероятность Р=а качественной сборки экспоненциально убывает при x < 0x - количество нуклеотидов в последовательности, а основание показательной функции а число нуклеотидов качественно отличающихся друг от друга A, G, C и T а=4, если при абиогенезе полипептидная последовательность строилась спонтанно из набора 20 аминокислот а=20 Вероятность случайного возникновения полипептидной цепи фермента carboxypeptidase  длинной в 300 аминокислот  равна (1/20)300 или  2,04*10-390. То есть при спонтанной количественной сборки полинуклеотидных и полипептидных цепей при абиогенезе внутри протоклетки, вероятность качественной сборки падает(убывает) экспоненциально увеличения количества нуклеотидов в цепи. Пра абиогенезе в пространстве протоклетке нам нужно собрать как минимум 61 АМИНОАЦИЛ-тРНК-СИНТЕТАЗЫ. Большинство аминоацил-тРНК-синтетазы состоит из 1, 2 или 4 одинаковых полипептидных цепей.  Молекулярная масса полипептидных цепей 30-140 тыс это полипептидная последовательность аминокислот 273 -1273 соответственно на одну цепь, а из может быть в четверичной структуре 4. Аминоацил-тРНК-синтетаз состоящая из четырех цепей каждая имеет 1273 аминокислоту, то для сборки аминоацил-тРНК-синтетазы из четырех одинаковых третичных структур нужно 5091 аминокислота. Каждая из 20 аминоацил-тРНК синтетаз должна всегда прикреплять к тРНК только свою аминокислоту, узнавая только одну из 20 протеиногенных аминокислот и не связывая другие похожие молекулы, содержащиеся в цитоплазме протоклетки. Если в протоклетке в цитоплазме хирально грязная смесь состоящая из 40 видов  аминокислот 20L- и 20D- изомеров, а сборка должна быть хирально чистой, то при спонтанной сборке (синтезе) количественной последовательности вероятность  качественной сборки будетР=а, где а=40, х=5091, тогда Р=40-5091. а нужно как минимум 20 аминоацил-тРНК-синтетазы под каждую аминокислоту или 61 аминоацил-тРНК-синтетазы под каждый антикодон тРНК. И все это в одно время в небольшом пространстве протоклетки, а не в огромном пространстве Метагалактики.  Р=20*40-5091  или Р=61*40-5091
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 20.09.2020, 15:48:11
Если это требуется, надо создавать новое устройство. Ровно так же, как и в случае, когда
Ну, можно сказать, что устройство новое. Но после такой перепрошивки достаточно в программе для этого устройства заменить старые коды на новые, чтобы всё работало как прежде. Иная ситуация для генетической информации: после изменения "кодов" (кодонов) для того, чтобы всё работало как прежде, необходимо изменить
 химические свойства рибосом. Если уж сравнивать биосинтез белка с компьютерной программой, то генетическая информация ДНК - это не код, а данные. А кода нет ))
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 20.09.2020, 16:06:49
я уверен, что Всемогущий Бог, разумеется, мог направить химическую эволюцию на нашей планете таким образом, чтобы ДНК и РНК образовались совершенно естественным путем, так же, как и все прочее, сотворенное Им.
Если направленное - это совершенно естественное, то какая разница между "направленным" и "естественным"? Естественное - это несовершенное "направленное"? Направленное - это совершенное "естественное"?
Поясните, пожалуйста.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 20.09.2020, 16:20:09
это не код, а данные. А кода нет ))
Кажется я начал догадываться, что Вы имеете в виду. 

Код и данные и в программах не всегда можно разделить (в современных программах довольно редко можно разделить). Причём на любом уровне программирования. Например, текстовые данные содержат теги и даже могут быть довольно сложной программой.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 20.09.2020, 16:42:43
Я о том, что такого рода огромные тексты вызывают отторжение :( Мне интересна биология, но я предпочту читать это в хорошей книге известного автора, а не в виде цитат на богословском (!) форуме.
Даниэль, метод у меня такой своими словами показывать доказательную базу, есть гугл чтобы там найти подтверждения или опровержения на более качественном уровне.



Цитировать
Если я верно понимаю, вы ведь верующий человек, православный. Разве вы отрицаете, что Бог создал наш мир, жизнь и человека? Разве вам нужно вмешательство какого-то дополнительного разума, какой-то цивилизации?
все мои посты это попытка показать следы внешнего по отношению к Вселенной Разума, который верующие люди понимают как Бог. проблему не решают инопланетные цивилизации, у них тажа самая проблема, их должен создать внешний Разум. Для нашей Вселенной наука определила очень молодой возраст 14000000000 лет. Этого срока недостаточно для спонтанного возникновения жизни на Земле. Нужен активный внешний творческий Разум. Бог создал жизнь на Земле и возможно миллиарды миллиардов планет с условиями жизни от ада до Рая, способен телепортировать человека туда не прибегая к световым переносам информации, использовать мгновенную телепортацию в любую точку Вселенной, и так дать человеку заслуженную обитель. Это я к тому, чтобы объяснить зачем Бог создал такую большую Вселенную.   

Цитировать
Я не отрицаю, что это возможно, более того, имею основания предполагать, что иные цивилизации действительно вмешивались в процесс развития жизни. Но... все же полагаю, что это вторично.
Я эту тему не поднимаю, иные цивилизации если они есть, тоже имеют те же проблемы что и мы. Мне нравится Звездный крейсер Галактика, религиозный мотив, так же как и в Гарри Потере,но это красивая сказка. Атеист знаменитый советский астрофизик Шкловский в силу маловероятности спонтанного возникновения возникновения жизни считал что мы совершенно одиноки во Вселенной. Возможно мы та единственная цивилизация, которая размножается по всей Вселенной, только не нужно будет использовать Звездный крейсер Галактика.   

Цитировать
Первично творение мира, как оно описано в Библии. И я уверен, что Всемогущий Бог, разумеется, мог направить химическую эволюцию на нашей планете таким образом, чтобы ДНК и РНК образовались совершенно естественным путем, так же, как и все прочее, сотворенное Им. Богу не нужны помощники!
Библейское повествование Шестоднева прошло через цензуру сознание человека, и описано так как это понимал человек соответственно уровню естествознания того времени, но в плане эволюции жизни там всё последовательно и не противоречит современным научным представлениям сначала растительный мир подготовил среду обитания фотосинтез обогатил биогенным кислородом атмосферу, потом животный мир и на конец человек. Эволюция первой протоклетки это не череда спонтанных плохих и хороший мутаций программы ДНК,где хорошие побеждают плохих, это сверхъестественное творческое вмешательство Бога в естественные процессы Им же установленные. Бог по ходу самой эволюции жизни дописывает Геном, простые формы жизни автоматически по новой программе обретают новые формы и функции. Если условия среды меняются, редактируется и программа ДНК, под изменения среды обитания, если настала длительная засуха, и обитатели воды  в место жабров в следующем поколении получат легкие и вместо плавников конечности для передвижения по суше. Родители умрут, а дети в зародыше изменятся и выживут в новых условиях. творение идет от простого у сложному путем редактирования и дополнения новых программ в ДНК. среда косвенно влияет на изменение в программе ДНК, её меняет Бог подстраивая жизнь под изменения среды. так появилось эволюционное древо жизни. я и пытаюсь показать что спонтанные мутации не могут быть причиной всего многообразия жизни, вероятность спонтанного возникновения этого многообразия жизни практически равна нулю. Противников Бога больше всего бесят эти выкладки вероятностей, они с пеной у рта, отрицают этот аргумент, приписывая спонтанным процессам естественную логичность, да жизнь едет от простого к сложному естественным путем, законы физики и химии для всех одинаковы, но этот путь количественный, а не качественный, и чем сложней качественная организация, тем сложней ей достичь спонтанными шагами, шаг вперед, десять тысяч и более шагов назад и в стороны. Ученым в лаборатории в искусственной липидном пузыре удалось собрать беспорядочных цепочку нуклеотидов.

 Они взяли короткие молекулы ДНК с затравкой и с недореплицированным «хвостиком», состоящим из 15 нуклеотидов Ц (цитидинов). Молекулы были помещены внутрь мембранных пузырьков (https://elementy.ru/novosti_nauki/430749/Iskusstvennye_protokletki_sinteziruyut_DNK_bez_pomoshchi_fermentov).

Эти пузырьки с начинкой — модельные протоклетки — поместили в среду, оптимальную для неферментативного синтеза ДНК (pH 8,5, температура 4°C, плюс еще два простых органических соединения, теоретически совместимых с представлениями о первичном бульоне). После этого протоклетки стали получать «пищу» — активированные нуклеотиды. Официальное название «корма»: 2'-амино-2',3'-дидеоксигуанозин-5'-фосфоримидазол. Время от времени часть протоклеток извлекалась из раствора, чтобы посмотреть, как идет репликация.

Шла она хорошо, хоть и медленно. В конце концов все протоклетки справились с задачей, то есть закончили репликацию недореплицированных молекул ДНК, пристроив к каждому из 15 цитидинов (Ц) комплементарный ему гуанозин (Г). На это у них ушло 24 часа, по 96 минут на нуклеотид. В настоящих живых клетках репликация ДНК осуществляется в десятки миллионов раз быстрее, но ведь там есть сверхэффективные катализаторы — ферменты.               
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 20.09.2020, 17:11:01
Кажется я начал догадываться, что Вы имеете в виду. 

Код и данные и в программах не всегда можно разделить (в современных программах довольно редко можно разделить). Причём на любом уровне программирования. Например, текстовые данные содержат теги и даже могут быть довольно сложной программой.
Не догадались. Трава - пища для кролика, а кролик - пища для лисы. Но в синтезе белка информация ДНК - данные, а не программа.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 20.09.2020, 17:13:51
Но в синтезе белка информация ДНК - данные, а не программа.
Машину Тьюринга изучали? Где там программа, а где данные?
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 20.09.2020, 19:37:32
Если направленное - это совершенно естественное, то какая разница между "направленным" и "естественным"? Естественное - это несовершенное "направленное"? Направленное - это совершенное "естественное"?
Поясните, пожалуйста.
Это и есть вопрос темы, который было бы интересно расследовать.

Что касается Бога, то Он по определению направляет абсолютно все естественное - иначе какой же Он Бог? Так что здесь даже вопроса для обсуждения нет. Возьмите любое естественное явление, даже падение знаменитого волоса с головы - и окажется, что оно направлено Богом. Или возьмите любое явление, направленное Богом - и окажется, что оно естественно, поскольку Бог и есть Создатель всего естественного.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 20.09.2020, 19:43:37
Даниэль, метод у меня такой своими словами показывать доказательную базу, есть гугл чтобы там найти подтверждения или опровержения на более качественном уровне.
Я понимаю, но поймите, пожалуйста: это неудобно для собеседников. Мы все, слава Богу, как-то умеем пользоваться Google.


все мои посты это попытка показать следы внешнего по отношению к Вселенной Разума, который верующие люди понимают как Бог.
Стоп, стоп. Внешний по отношению к Вселенной разум - это язычество либо инопланетные цивилизации. Бог в монотеизме не "внешний", Он Создатель всей нашей Вселенной! Он закладывал те самые законы, по которым развивались химические соединения, а позже - жизнь и разум. Если Он есть, если Он направлял развитие ДНК, то никакого внешнего Разума нет, все произошло естественно и по воле Бога!

Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 20.09.2020, 21:27:20
Машину Тьюринга изучали? Где там программа, а где данные?
Они там.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 21.09.2020, 01:28:01
Я понимаю, но поймите, пожалуйста: это неудобно для собеседников. Мы все, слава Богу, как-то умеем пользоваться Google.
Очень рад за вас.

Цитировать
Стоп, стоп. Внешний по отношению к Вселенной разум - это язычество либо инопланетные цивилизации.
Язычество предполагает пантеизм, где бог вся Вселенная, где тут внешнее отношение? Все возможные инопланетяни это как и человек это внутренней локальный разум вселенной локализованный в нейронных сетях головного мозга, человеческий разум это взаимодействия духа ума и психофизики головного мозга,но ум это образ и подобие Бога, поэтому мы можем умом взаимодействовать с Умом Бога. Я специально выделяю заглавными буквами различие между тварным и Нетварным.   


Цитировать
Бог в монотеизме не "внешний",
между Природой Бога и тварной природой онтологическая бездна, как тварь человек бесконечно отдален своим конечным вектором ума от Бога, образ такой, единичный шаг, ограниченная скорость, никогда невозможно прошагать путь в бесконечность. Природа Бога непостижима нашим коротким умом, но это не означает что у бога нет способов преодолеть бесконечную онтологическую пропасть и низойти действием к человеку, так что Бог становится ближе чем это может себе представить человек. Самый удобный способ коммуникации между Богом и человеком, это когда Бог творить человека и выбирает из его потомков тело в котором пересекается божественная и человеческая личности. Несториане предлагали некий интегральный союз божественной и человеческой личностей, Православные и Католики полагают что достаточно божественной Личности, но суть такова Машиах Царь всей Вселенной. Почему Бог мог использовать неопалимую купину для общения с Моисеем, несгораемый в огне куст, говорящий с Моисеем, а в Человеке Иисусе Христе Бог не может говорить с Моисеем. Бог в Иисусе Христе уже не внешний, когда Божественная Личность управляет человеческой природой. 1Кор.2:16 Ибо кто познал ум Господень, чтобы мог судить его? А мы имеем ум Христов.     

Цитировать
Он Создатель всей нашей Вселенной! Он закладывал те самые законы, по которым развивались химические соединения, а позже - жизнь и разум.
Византийский богослов Св. Григорий Палама учил: "Бог есть и называется естеством всех существ,
ибо все являются Его причастниками и образуются Его причастием; не причастием
Его естества, да не будет, но причастием Его энергии; ибо в этом смысле Он является
и бытийностью существующих... и вообще всем для всех".​
нетварная энергия это нетварное действие Бога, модус бытия Бога по отношению к сотворенному инобытию, божественное нисхождение, причина всего и вся в инобытии, само инобытие это тварное следствие. Молекула существует в силу того что у неё есть нетварная причина.  Идея причина вещь следствие. Божественная нетварная причина, и как следствие законы природы.   

Цитировать
Если Он есть, если Он направлял развитие ДНК, то никакого внешнего Разума нет, все произошло естественно и по воле Бога!
Иез.28:6 за то так говорит Господь Бог: так как ты ум твой ставишь наравне с умом Божиим, Разум Бога заменим на Ум.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 21.09.2020, 02:48:16
Не догадались. Трава - пища для кролика, а кролик - пища для лисы. Но в синтезе белка информация ДНК - данные, а не программа.
триплет-кодон это то что дано на последовательности ДНК, Ген последовательность триплетов на последовательности ДНК. Данные, нам дана последовательность нуклеотидный пар. И всё! Чтобы эта последовательность нуклеотидов обрела суть смысловой последовательности нужен подобрать  правильный генетический код. Подобрали правильный генетический код.
(http://900igr.net/up/datas/150832/006.jpg)
теперь полинуклеотидная последовательность Гена стала осмысленной и выглядит так.
(https://present5.com/presentation/437737607_451949514/image-54.jpg)
Каждый участок кодонов выполняет особые смысловые функции.
РНК-полимераза имеет шаговый двигатель считывания в шаг три нуклеотида. Тут ищут в ДНК компьютерные программы, а тут линейная функциональная программа. Механизм репликации выделяет участок гена (реплика) и механизм транскрипции копирует этот участок ДНК на матричную мРНК, механизм трансляции переносит скопированную на матричную мРНК последовательность на рибосому, шаговый двигатель рибосомы с шагом три нуклеотида двигается по матричной мРНК.
(https://refdb.ru/images/1334/2666910/m6c9ab793.png)
 направление движения считывающего механизма от 5 ->3 движение тРНК в противоположном направлении. В большой рибосомной единицы находятся два участка, в участке 1 находится активная зона присоединения аминокислоты к полипептидной последовательности, но транспортная тРНК с присоединенной к ней аминокислотой заходит в участок 2, труда может зайти только та тРНК, у который антикодон комплементарен кодону на мРНК, движение рибосомы пошагово и непрерывно по мРНК, поэтому в участке 2 кодирующий кодон последовательно изменяется на новый, поэтому во второй участок заходит новая тРНК с соответствующим кодону на мТРК комплементарному антикодону, предыдущую тРНК из 2 участка вытесняют в участок 1, где аминокислота отсоединяется от тРНК и присоединяется к полипептидной цепи, рибосома делает следующий шаг, по матричной мРНК, в участке 2 появляется новый кодон на мРНК, туда заходит новая тРНК с новой аминокислотой, вталкивая предыдущую тРНК с аминокислотой в участок 1,где отсоединяется аминокислота от тРНК и присоединяется у полипептиду, при этом первая из трех тРНК без аминокислоты выталкивается второй наружу рибосомы. как видно все процессы механические, клетка работает как механический станок с функциональной программой или пошаговой последовательности процесса декодирования на рибосоме с программного носителя мРНК. Всё зависит от программы последовательности, от того какие кодоны были вписаны в полинуклеотидную последовательность это и есть генетическая программа, не компьютерная, она проста и эффективна, а последовательность встроена с функциональным смыслом неслучайно собранная.         
(https://fsd.multiurok.ru/html/2017/08/28/s_59a3e66fa573e/679188_3.png)

Код разработал Эмиль Бодо в 1870 году для своего телеграфа. Код вводился прямо клавиатурой, состоящей из пяти клавиш, нажатие или ненажатие клавиши соответствовало передаче или непередаче одного бита в пятибитном коде. Максимальная скорость передачи — чуть больше 190 знаков в минуту (примерно 16 бит или 3 бода в секунду).
(http://900igr.net/up/datas/266671/023.jpg)   
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 21.09.2020, 09:11:42
Он ещё про мультивселенную рассказывал (в следующем параграфе). Если миллиарда планет мало для случайного возникновения жизни, может быть неизвестное количество вселенных. Суть в том, что неправильно использовать Бога как затычку. https://ru.wikipedia.org/wiki/Бог_белых_пятен
Мудьтивселенные это антинаучная гипотеза и не более, так как не варифицируема. Если оперировать научным подходом, то случайная жизнь не возможна. Поэтому атеистам остаётся полагаться на недоказуемые гипотезы?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 21.09.2020, 09:17:39
Есть естественный отбор. Он не защищает, но полезные мутации остаются.В чём отличие от аргумента про невозможность постепенного формирования глаза?
Не защищает, но остаются? Это взаимоисключающие понятия. С какой стати им оставаться, если не защищены? Они так же, в любую секунду могут стать и отрицательными мутациями, ничто им это не запрещает.

Развитие глаза возможно от простого к сложному, как от лупы и до 4К видео. Но инсулин или он есть или его нет. Не существует более простого инсулина.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 21.09.2020, 09:23:05
Да. Зачем вы это написали?Верующие в коде видят руку Бога: код для компьютеров сочиняют программисты, а код для живых существ сочинил Бог. Это заблуждение. Где заблуждение - там нет истины. Где нет истины - там нет Христа. Где нет Христа - там погибель. Где погибель - там плохо. Чисто сострадание.
Некоторые программисты не понимают, что такое код.
Почему это заблуждение, если это вытекает из логики? В чём логическая ошибка?

Чем понятие кода этих программистов отличается от вашего, например?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 21.09.2020, 09:25:16
Так, что бы в итоге не получилось, оно получится в строгом соответствии с законами химии. Получается, вы по собственному произволу решаете какой результат осмыслен, а какой нет. А проверить это никак нельзя.
И, вот это большой минус вашей гипотезе, отсутствие возможности проверки (критерий научности).
Так и перфолента передаёт в строгом соответствие с законами физики. Так в чём различие?
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 21.09.2020, 09:26:20
Мудьтивселенные это антинаучная гипотеза и не более, так как не варифицируема. Если оперировать научным подходом, то случайная жизнь не возможна. Поэтому атеистам остаётся полагаться на недоказуемые гипотезы?
Можно считать мультивселенную альтернативной затычкой.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 21.09.2020, 09:28:39
Почему это заблуждение, если это вытекает из логики? В чём логическая ошибка?

Чем понятие кода этих программистов отличается от вашего, например?
Дело не в логике, а в семантике.

Об этом уже было сказано достаточно.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 21.09.2020, 09:31:14
Перфолента без условных знаков это перфолента без дырок, как выглядит ДНК без условных знаков??Нет, вы показали, именно то о чем я говорил, для понимания и объяснения суперсложных процессов, происходящих с ДНК применяются аналогии.
Аналогия эта подходит, но это совершенно не значит, что ДНК действительно является информационно-семиотическим феноменом. Обратите внимание на слово "как" в названии статьи.
Перфолента с хаотичным набором дырок будет приравнена к ДНК с хаотичным порядком нуклеотидов?

А посмотрите на вторую статью, там слова "как" нету. И где научная статья, которая бы объясняла, что код ДНК это и не код вовсе?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 21.09.2020, 09:32:34
Аналогия подходит, пользоваться ей можно, но это совершенно не значит, что ДНК содержит какую-то семантику. Подтверждением было бы, если бы вы показали эту семантику непосредственно в ДНК, а так, мало ли что на что похоже...

А, утверждение делаете вы, вам его и доказывать. :)
Тогда не понятно, почему семантика ДНК это не семантика. Теперь ваша очередь доказывать своё утверждение.  :D
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 09:54:54
Генетическое программирование - это случайные изменения на ограниченном и очень специфически подобранном поле изменений (которые заведомо ничего не испортят фатально),
Почему вы так думаете?

Цитировать
и отбор вовсе не "естественный", а искусственный, по грамотно продуманному критерию. И то, и другое разумно планируется - так, чтобы зная примерно какого рода программа нужна, подобрать наиболее оптимальную комбинацию её блоков.
А в природе "грамотно продуманный критерий" это приспособленность организма. Никакой принципиальной разницы между естественным и искусственным отбором нет.
Цитировать
Осуществляется в этом деле не вообще абстрактная эволюция в чём только можно, а достигается заранее поставленная цель оптимизации (через хорошо продуманный критерия отбора). Как только цель достигнута, эволюция прекращается! Никакие другие цели сами собой ставиться и достигаться не будут.
Ровно тоже самое и в природе. Как только организм хорошо приспособился к условиям отбор начинает работать против любых изменений, до тех пор пока условия не меняются и не возникает необходимость приспосабливаться снова.

По факту, мы имеем прекрасную иллюстрацию работы эволюционных факторов. И никакого итога в виде неизбежной гибели там не наблюдается, а наблюдается ровно обратное.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 10:13:33
Это ничего не доказывает. Громоздкие сооружения, переполненные деталями, конечно, резко отличаются от природных феноменов, но ведь громоздкость технологии - просто признак несовершенства и недостатка разума. Еще более показательно взять в качестве примера... городскую свалку. Вот такого в природе точно нет :)
305-ти миллиметровое орудие "Дредноута", несомненно громоздкое, если сравнивать его с пращой Давида, надо ли понимать, что это от недостатка разума?
Цитировать
По мере совершенствования лишние детали исчезают. Искусственный глаз (https://news.israelinfo.co.il/health/89501) уже гораздо меньше похож на монструозный дредноут и больше - на биологические механизмы.
По вашей ссылке написано, что этот искусственный глаз будет первым, непонятно с чем вы его сравниваете.
Цитировать
Другой пример: колесо. Это древнейшее из известных изобретений, причем одно из самых гениальных. Объясните мне, как, глядя на каменное или деревянное колесо, доказать, что оно искусственное? Если, разумеется, не знать, что есть такой человек, который изобрел колесо. Круглые предметы в природе, да, встречаются.
Нужно искать следы агентов способных производит такие колеса и изучать естественные процессы способные давать такой результат. Если подходящих природных процессов нет, а следы агентов есть, вот вам и доказательство.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 10:16:12
Если оперировать научным подходом, то случайная жизнь не возможна.
О как! Уже и случайная жизнь невозможна! :(
А, почему, позвольте узнать?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 10:33:55
Не защищает, но остаются? Это взаимоисключающие понятия. С какой стати им оставаться, если не защищены?

Вы под "защищает" что понимаете? Естественный отбор удаляет из популяции вредные мутации.
Полезные мутации защищать не нужно, они и так дают преимущество своим обладателям.
Цитировать
Они так же, в любую секунду могут стать и отрицательными мутациями, ничто им это не запрещает.
Не в любую секунду. Вредная мутация может возникнуть при передаче генетической информации, то есть у потомков. Так ЕО уберет ее из популяции тем верней чем вреднее она будет. Только и всего.

Цитировать
Развитие глаза возможно от простого к сложному, как от лупы и до 4К видео. Но инсулин или он есть или его нет. Не существует более простого инсулина.
Так на белках все и построено. Белки, разумеется,  тоже эволюционируют.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 10:59:18
Перфолента с хаотичным набором дырок будет приравнена к ДНК с хаотичным порядком нуклеотидов?
По каким параметрам она может быть приравнена к ДНК?

Еще раз.
С перфолентой проблем нет. Информация, кем то задуманная для передачи, определённым физическим образом нанесена на нее.
Перфолента с информацией физически отличается от диска без информации.
Лист бумаги с кирилицей на ней отличается от чистого листа бумаги.

Ничего подобного о ДНК сказать нельзя.
Как вы предлагаете фальсифицировать ваше утверждение о наличии в ДНК информации, заложенной туда для последующей передачи?
Каким образом вы предлагаете отличить ДНК с информацией от нуклеотида без информации?
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?

Цитировать
А посмотрите на вторую статью, там слова "как" нету.
Посмотрел. Там словосочетания типа: генетический язык, пустое слово, знаки препинания, информационная РНК употребляются в кавычках.
Что бы это значило?

Кавы́чки — парный знак препинания, который употребляется для выделения прямой речи, цитат, отсылок, названий предприятий, литературных произведений, газет, журналов, а также отдельных слов, если они включаются в текст не в своём обычном значении, используются в ироническом смысле, предлагаются впервые или, наоборот, как устаревшие и тому подобное.
И где научная статья, которая бы объясняла, что код ДНК это и не код вовсе?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 11:01:00
Тогда не понятно, почему семантика ДНК это не семантика.
Потому, что никто еще не доказал, что там есть семантика.

Цитировать
Теперь ваша очередь доказывать своё утверждение.  :D
Какое? :)
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 21.09.2020, 14:25:17
Они там.
Там?

Там лента и головка.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 21.09.2020, 15:57:30
Язычество предполагает пантеизм, где бог вся Вселенная, где тут внешнее отношение?
Пантеизм - это одно из философских течений. Я же говорил об обыкновенном язычестве, там, где действуют разного рода божественные личности: Гея и Уран, Зевс и Гера, Осирис и Ра, Один и Локи и т.д.

Предположение, что в какой-то момент в естественную эволюцию сложных молекул вмешался некий "внешний разум", полностью лежит в русле язычества. Вот, Зевс что-то там "колданул", и появились молекулы РНК. Представления о языческих богах созданы на основе представлений о человеке, они как бы "созданы по образу и подобию человека". Поэтому называть их "разумом" вполне легитимно, коль скоро они сотворены по образу и подобию единственного известного нам разума.

Но Бог - это не "разум"! И тем более не "внешний". Он Творец любого разума, Творец всего внешнего и внутреннего. К Нему подобные эпитеты просто неприменимы. Разве что в порядке поэтической метафоры, как в песне Давида, где Бог "воссел на керува и полетел". И, само собой, Он не вмешивался "чудесным образом" в ход биологической эволюции, подобно гипотетическому Зевсу или инопланетянам, чтобы что-то там "слегка подправить", подобно наглому редактору, который исправляет какие-то важные элементы в тексте книги. Наоборот, Он и есть Автор книги, Автор всего плана эволюции, от Большого взрыва и до конца дней.

между Природой Бога и тварной природой онтологическая бездна, как тварь человек бесконечно отдален своим конечным вектором ума от Бога, образ такой, единичный шаг, ограниченная скорость, никогда невозможно прошагать путь в бесконечность. Природа Бога непостижима нашим коротким умом, но это не означает что у бога нет способов преодолеть бесконечную онтологическую пропасть и низойти действием к человеку, так что Бог становится ближе чем это может себе представить человек. Самый удобный способ коммуникации между Богом и человеком, это когда Бог творить человека и выбирает из его потомков тело в котором пересекается божественная и человеческая личности. Несториане предлагали некий интегральный союз божественной и человеческой личностей, Православные и Католики полагают что достаточно божественной Личности, но суть такова Машиах Царь всей Вселенной. Почему Бог мог использовать неопалимую купину для общения с Моисеем, несгораемый в огне куст, говорящий с Моисеем, а в Человеке Иисусе Христе Бог не может говорить с Моисеем. Бог в Иисусе Христе уже не внешний, когда Божественная Личность управляет человеческой природой. 1Кор.2:16 Ибо кто познал ум Господень, чтобы мог судить его? А мы имеем ум Христов.     
 Византийский богослов Св. Григорий Палама учил: "Бог есть и называется естеством всех существ,
ибо все являются Его причастниками и образуются Его причастием; не причастием
Его естества, да не будет, но причастием Его энергии; ибо в этом смысле Он является
и бытийностью существующих... и вообще всем для всех".​
нетварная энергия это нетварное действие Бога, модус бытия Бога по отношению к сотворенному инобытию, божественное нисхождение, причина всего и вся в инобытии, само инобытие это тварное следствие. Молекула существует в силу того что у неё есть нетварная причина.  Идея причина вещь следствие. Божественная нетварная причина, и как следствие законы природы.   
Иез.28:6 за то так говорит Господь Бог: так как ты ум твой ставишь наравне с умом Божиим, Разум Бога заменим на Ум.
Все это красиво и, наверно, правильно с православной точки зрения (я не могу это оценить). Но при чем тут наша тема?

Вы лишь косвенно подтверждаете мои слова - Бог абсолютен, сравнивать Его с человеком некорректно, Он Автор всех законов природы. Понятие "искусственный" первоначально возникло для обозначения результатов человеческой деятельности, в противовес результатам действия законов природы. Но Бог - Творец и того, и другого, причем человек (пока что) занимает во Вселенной ничтожную часть. Называть то, что сотворено Богом, "искусственным" - это просто оксюморон, сочетание несочетаемого, абсурд.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 21.09.2020, 16:16:57
305-ти миллиметровое орудие "Дредноута", несомненно громоздкое, если сравнивать его с пращой Давида, надо ли понимать, что это от недостатка разума?
Ну уж точно не от избытка :) Собственно, действительно разумное существо вообще не создавало бы никакого оружия.

Между тем, если сравнивать конструкцию пращи и пушки, то, очевидно, праща гениальнее. Минимум предметов - камень и веревка. Функциональная законченность и эстетичность. При этом высочайшая эффективность - Давид легко убил тяжеловооруженного Голиафа. Собственно, точно так же он мог бы убить и современного морпеха. А вообще-то праща была нужна ему для охоты на крупных животных.

По вашей ссылке написано, что этот искусственный глаз будет первым, непонятно с чем вы его сравниваете.
Что непонятно? Этот глаз, как и другие пока еще крайне несовершенные достижения современных технологий, все же ближе по устройству к биологическим предметам, нежели к корявым дредноутам.

Собственно, почти вся история человеческой техники, кроме некоторых гениальных находок вроде колеса или электричества. - это стремление воспроизвести те или иные механизмы живой или неживой природы. Рычаг, дубина, одежда, крыло... Вполне логично предположить, что в результате вершиной развития технологий станут инструменты, неотличимые от природных, например, биороботы, состоящие исключетельно из органических тканей. Будете оспаривать? Но если вершина искусственности совпадает с естественностью, то, следовательно, сам ваш подход к критериям искусственности никуда не годится.

Нужно искать следы агентов способных производит такие колеса и изучать естественные процессы способные давать такой результат. Если подходящих природных процессов нет, а следы агентов есть, вот вам и доказательство.
Ну а что вы будете делать, если не смогли найти ни следов агентов (ибо прошли миллиарды лет), ни подходящие природные процессы (ибо нужное сочетание условий вот уже миллиард лет не случалось)? С ДНК именно такая ситуация. Если кто-то когда-то запрограммировал рибосомный микрокомпьютер, то за миллиарды лет все следы посещения им нашей планеты исчезли (а может быть, их и не было - сверхразум вовсе не обязан оставлять следы). Однако, современная наука не знает таких процессов, в результате которых самопроизвольно возникли бы ДНК или подобные им структуры.

Критерий искусственности объекта, если это настоящий критерий, должен опираться на параметры самого объекта. Параметры, доступные для объективного изучения и оценки вне всякой связи с историческими сведениями. Кроме того, он не должен зависеть от уровня развития современной науки. Мало ли, может быть, мы просто еще не открыли те природные механизмы, которые приводят к появлению колеса (или ДНК). С пульсарами произошло именно это: вначале казалось, что естественным образом неоткуда взяться столь частым повторяющимися радиосигналам; а потом открыли нейтронные звезды.

С другой стороны, если кто-то зарегистирирует из космоса сигналы, воспроизводящие ряд простых чисел, то, согласно общему мнению, это может считаться признаком искусственности сигнала. Вопрос: почему? Разве мера нашего незнания, как такое может получиться, может служить критерием? Чтобы разгадать загадку пульсаров, хватило пары десятилетий. Может быть, изучая Вселенную пару миллионов лет, люди найдут и те природные механизмы, которые порождают ряд простых чисел?
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 21.09.2020, 16:23:47
Мудьтивселенные это антинаучная гипотеза и не более, так как не варифицируема. Если оперировать научным подходом, то случайная жизнь не возможна.
А как вы можете это доказать? Если науке неизвестен механизм естественного появления чего-либо, то это не значит, что его не существует.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 21.09.2020, 18:18:08
По каким параметрам она может быть приравнена к ДНК?
линейная последовательность 5 битных кодонов. Код Бодо́ — цифровой, первоначально синхронный 5-битный код.(http://900igr.net/up/datas/266671/023.jpg)
Генетический код
(http://900igr.net/up/datas/150832/006.jpg) 
Цитировать
Еще раз.
С перфолентой проблем нет. Информация, кем то задуманная для передачи, определённым физическим образом нанесена на нее.
Так и о полинуклеотидной перфоленте ДНК можно сказать, с перфолентой ДНК проблем нет. Информация, кем то задуманная для передачи, определённым физическим образом нанесена на нее.



Цитировать
Цитировать
Цитата: Игорь Соколов от Сегодня в 09:31:14
Перфолента с хаотичным набором дырок будет приравнена к ДНК с хаотичным порядком нуклеотидов?
Перфолента с информацией физически отличается от диска без информации.
Лист бумаги с кириллицей на ней отличается от чистого листа бумаги.


Ничего подобного о ДНК сказать нельзя.
Как вы предлагаете фальсифицировать ваше утверждение о наличии в ДНК информации, заложенной туда для последующей передачи?

Точно также как вы утверждаете что кто то дырки нанес на перфоленту.

Цитировать
Каким образом вы предлагаете отличить ДНК с информацией от нуклеотида без информации?
для перфоленты есть Код Бодо́, для перфоленты ДНК есть генетический код. Имея последовательность триплетов каданов на перфоленте и кодировочную таблицу, зная правила генетической пунктуации и орфографии построения гена, мы без рибосомы перенесем информацию с перфоленты ДНК в обычную тетрадь к клеточку используя химические формулы аминокислот в последовательность аминокислот сначала в первичную структуру это первый смысл, потом скрутим полипептидную ниточку в упаковочную полипептидную спираль, как будет скручиваются эта спираль мы знаем из первичной структуры полипептида. Также из первичной структуры мы знаем как будет упаковочная в спираль полипептидная цепь складывается в третичную структуру, тоже касается и четвертичной структуры, всё зависит от точной последовательности аминокислот первичной структуры, которая записана на перфоленте ДНК. Информацию на перфоленте и полинуклеотидной цепи ДНК читается с помощью Кода Бодо́ и генетического кода соответственно.     


Цитировать
Что отличает то, что вы называете "информацией" от химических реакций возникающей в определённых условиях и протекающих/заканчивающаяся определённым результатом?
химические реакции это химические и физические механизмы, как механизмы в машине телеграфа, а информация это последовательный функциональный смысл с логикой. Если мы имеем определенный набор дырок на перфоленте в начале, то на другом конце декодирующей машины мы будем иметь определенный знак или действие. Перфолента ДНК имеет в начале триплет кодон, на конце мы будем иметь определенную аминокислоту.   

Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 21.09.2020, 18:22:19
Пантеизм - это одно из философских течений. Я же говорил об обыкновенном язычестве, там, где действуют разного рода божественные личности: Гея и Уран, Зевс и Гера, Осирис и Ра, Один и Локи и т.д.

Предположение, что в какой-то момент в естественную эволюцию сложных молекул вмешался некий "внешний разум", полностью лежит в русле язычества. Вот, Зевс что-то там "колданул", и появились молекулы РНК. Представления о языческих богах созданы на основе представлений о человеке, они как бы "созданы по образу и подобию человека". Поэтому называть их "разумом" вполне легитимно, коль скоро они сотворены по образу и подобию единственного известного нам разума.

Но Бог - это не "разум"! И тем более не "внешний". Он Творец любого разума, Творец всего внешнего и внутреннего. К Нему подобные эпитеты просто неприменимы. Разве что в порядке поэтической метафоры, как в песне Давида, где Бог "воссел на керува и полетел". И, само собой, Он не вмешивался "чудесным образом" в ход биологической эволюции, подобно гипотетическому Зевсу или инопланетянам, чтобы что-то там "слегка подправить", подобно наглому редактору, который исправляет какие-то важные элементы в тексте книги. Наоборот, Он и есть Автор книги, Автор всего плана эволюции, от Большого взрыва и до конца дней.
Все это красиво и, наверно, правильно с православной точки зрения (я не могу это оценить). Но при чем тут наша тема?

Вы лишь косвенно подтверждаете мои слова - Бог абсолютен, сравнивать Его с человеком некорректно, Он Автор всех законов природы. Понятие "искусственный" первоначально возникло для обозначения результатов человеческой деятельности, в противовес результатам действия законов природы. Но Бог - Творец и того, и другого, причем человек (пока что) занимает во Вселенной ничтожную часть. Называть то, что сотворено Богом, "искусственным" - это просто оксюморон, сочетание несочетаемого, абсурд.

Иез.28:6 за то так говорит Господь Бог: так как ты ум твой ставишь наравне с умом Божиим
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 19:07:02
Ну уж точно не от избытка :) Собственно, действительно разумное существо вообще не создавало бы никакого оружия.
Между тем, если сравнивать конструкцию пращи и пушки, то, очевидно, праща гениальнее. Минимум предметов - камень и веревка. Функциональная законченность и эстетичность.
Мой тезис был, что с развитием цивилизации все легче идентифицировать орудия, как искусственные. Праща Давида это кусок кожи на веревке/лиане + камень вполне естественные ингредиенты. А вот про пушку, такого уже не скажешь.

Цитировать
При этом высочайшая эффективность - Давид легко убил тяжеловооруженного Голиафа.
Голиаф жертва своего благородства. Поединщик вышел на честный бой, а ему залепили пращей.
Цитировать
Собственно, точно так же он мог бы убить и современного морпеха. А вообще-то праща была нужна ему для охоты на крупных животных.
Мог, но весь опыт колониальных войн показывает, что туземцы с гениальными пращами бессильны против морпехов с громоздкими орудиями.
Цитировать
Что непонятно? Этот глаз, как и другие пока еще крайне несовершенные достижения современных технологий, все же ближе по устройству к биологическим предметам, нежели к корявым дредноутам.
Вы искусственный глаз сравниваете с дредноутом?
Корректно ли это?

Цитировать
Ну а что вы будете делать, если не смогли найти ни следов агентов (ибо прошли миллиарды лет), ни подходящие природные процессы (ибо нужное сочетание условий вот уже миллиард лет не случалось)?
Миллиарды лет, в принципе, не помеха, сегодня специалисты обнаруживают следы пребывания бактерий в породах 3,5 млр летней давности. А вы говорите про высокотехнологичную цивилизацию.

Но, если следов агентов нет, а характер и количество находок колес не позволяют предположить, что это природные явления, то логично предположить, что колеса искусственные, тем более, что аналогия с человеческой технологией налицо.
Цитировать
С ДНК именно такая ситуация. Если кто-то когда-то запрограммировал рибосомный микрокомпьютер, то за миллиарды лет все следы посещения им нашей планеты исчезли (а может быть, их и не было - сверхразум вовсе не обязан оставлять следы). Однако, современная наука не знает таких процессов, в результате которых самопроизвольно возникли бы ДНК или подобные им структуры.
Нет, с ДНК ситуация совершенно иная. Искусственные предметы могут делать только живые разумные существа, иные агенты нам неизвестны. Если, мы находим колесо, то резонно предположить вмешательство разумного живого существа.
В случае с ДНК речь идет о появлении этих самых разумных живых существ. Допустим некие разумные живые существа могли запрограммировать и принести на землю ДНК. Но откуда они взялись сами? Так или иначе, мы упираемся в то, что жизнь должна была как-то где-то самозародится, поскольку о никаких сверхъестественных сущностях мы достоверными сведениями не располагаем.
Цитировать
Критерий искусственности объекта, если это настоящий критерий, должен опираться на параметры самого объекта. Параметры, доступные для объективного изучения и оценки вне всякой связи с историческими сведениями. Кроме того, он не должен зависеть от уровня развития современной науки. Мало ли, может быть, мы просто еще не открыли те природные механизмы, которые приводят к появлению колеса (или ДНК). С пульсарами произошло именно это: вначале казалось, что естественным образом неоткуда взяться столь частым повторяющимися радиосигналам; а потом открыли нейтронные звезды.
С другой стороны, если кто-то зарегистирирует из космоса сигналы, воспроизводящие ряд простых чисел, то, согласно общему мнению, это может считаться признаком искусственности сигнала. Вопрос: почему? Разве мера нашего незнания, как такое может получиться, может служить критерием? Чтобы разгадать загадку пульсаров, хватило пары десятилетий. Может быть, изучая Вселенную пару миллионов лет, люди найдут и те природные механизмы, которые порождают ряд простых чисел?
Можно фантазировать, а можно искать самое простое решение и проверять его. Именно этот путь и привел нашу цивилизацию к тем техническим высотам, где мы и находимся.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 21.09.2020, 19:13:38
Иез.28:6 за то так говорит Господь Бог: так как ты ум твой ставишь наравне с умом Божиим
Ты ведь именно вы так поступаете, когда называете Бога "внешним разумом"! Или я неверно вас понял?

Я понял так, что вы считаете тот факт, что Бог сотворил мир, в частности, жизнь и человека, причиной "искусственности" ДНК. Раз их создал Бог, "внешний разум", значит, они искусственные. Я же категорически против такого подхода. Ибо Бог создал вообще все и управляет абсолютно всеми естественными процессами, даже закипанием воды в чайнике.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 19:23:12
линейная последовательность 5 битных кодонов. Код Бодо́ — цифровой, первоначально синхронный 5-битный код.[img width=800
Генетический код
Вы невнимательны. Какой там код, если речь идет о случайных последовательностях.
Цитировать
Так и о полинуклеотидной перфоленте ДНК можно сказать, с перфолентой ДНК проблем нет. Информация, кем то задуманная для передачи, определённым физическим образом нанесена на нее.
Да? А кем и каким образом сказать сможете? ;)

Цитировать
Точно также как вы утверждаете что кто то дырки нанес на перфоленту.
Правда? Я-то, смогу показать того, кто нанес дырки на перфоленту, и смогу рассказать как он это сделал и зачем.
А вы? :)
Цитировать
для перфоленты есть Код Бодо́, для перфоленты ДНК есть генетический код. Имея последовательность триплетов каданов на перфоленте и кодировочную таблицу, зная правила генетической пунктуации и орфографии построения гена, мы без рибосомы перенесем информацию с перфоленты ДНК в обычную тетрадь к клеточку используя химические формулы аминокислот в последовательность аминокислот сначала в первичную структуру это первый смысл, потом скрутим полипептидную ниточку в упаковочную полипептидную спираль, как будет скручиваются эта спираль мы знаем из первичной структуры полипептида. Также из первичной структуры мы знаем как будет упаковочная в спираль полипептидная цепь складывается в третичную структуру, тоже касается и четвертичной структуры, всё зависит от точной последовательности аминокислот первичной структуры, которая записана на перфоленте ДНК. Информацию на перфоленте и полинуклеотидной цепи ДНК читается с помощью Кода Бодо́ и генетического кода соответственно.     
Вы можете повторять это утверждение пока hell freezes over, но до тех пор пока вы не продемонстрируете механизм интеграции "кода" непосредственно в "среде исполнения" и не докажете, что результаты работы ДНК обусловлены специфическим "кодом", а не естественными patterns, которые свойсттвены всем химическим соединениям, ваши утверждения обязаны быть и будут проигнорированы.
Цитировать
химические реакции это химические и физические механизмы, как механизмы в машине телеграфа, а информация это последовательный функциональный смысл с логикой. Если мы имеем определенный набор дырок на перфоленте в начале, то на другом конце декодирующей машины мы будем иметь определенный знак или действие. Перфолента ДНК имеет в начале триплет кодон, на конце мы будем иметь определенную аминокислоту.
Набор слов.
 Мы будем иметь такую же определенную кислоту в результате естественных patterns. Согласны? А, если нет, то почему?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 21.09.2020, 19:24:07
О как! Уже и случайная жизнь невозможна! :(
А, почему, позвольте узнать?
невозможна в смысле маловероятна, то есть стремится к невозможности. проблема научпопа в том что там очень легко для неучей лохов и детей маловероятные вещи делают вероятными. общие абстракции выдают за реальные вещи.
вы наверное прогуливали уроки физики в школе. не понимаете сути законов физики и химии.
(https://elementy.ru/images/news/heterotrophic_protocell_model_600.jpg)
Американцы сделали робкие попытки абиогенеза в лаборатории. Ясно что абиогенез должен идти в малом пространстве протоклетки, они искусственно создали из липидов мембрану протоклетки, поместили туда кусочки РНК и ДНК, наполнили активированным нуклеотидами протоклетку и попытались синтезировать полипептидную последовательность случайными присоединениями новых нуклеотидов. удалось нарастить готовые ДНК на 15 нуклеотидов. Скорость реакции 1,5 нуклеотида в час. Все новые приращения к исходным кусочкам ДНК имели случайный характер предопределенный законами физики.
Искусственные протоклетки синтезируют ДНК без помощи ферментов (https://elementy.ru/novosti_nauki/430749/Iskusstvennye_protokletki_sinteziruyut_DNK_bez_pomoshchi_fermentov) новые последовательности были бессмысленными. А у вас всё очень легко получается, когда не дружишь с математикой. Структура гена кодирующего тРНК содержит не только 76-94 нуклеотидов, но и 10+31 нуклеотид промотора и терминатора это 134 нуклеотида, так вот синтез генов кодирующих тРНК в эксперименте мог бы быть удачным с вероятностью 4-134 =10-78 при условии что ученым удалось искусственную цитоплазму искусственной протоклетки наполнить хирально чистыми активированным нуклеотидами, в природе хиральной чистоты в открытом водойми невозможно в реальности. тогда вероятность будет другой 8-134, но допустим учёным удалось добиться хирально чистого набора нуклеотидов в цитоплазме искусственной протоклетки. Даже если в этой лужи одновременно собираются 1018 последовательностей, то вероятность хотя бы одной удачной сборки 1018-78=10-60 то есть если миллиард миллиардов одновременных сборок будет происходить. С РНК всегда проще чем с белками, но вероятность стремится к нулю. А как легко всё это идет в научно популярных статьях борцов с "разумным замыслом".   

(http://childrenscience.ru/legacy/genetics/images/gen0301_2x.png)   
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 19:49:31
невозможна в смысле маловероятна, то есть стремится к невозможности. проблема научпопа в том что там очень легко для неучей лохов и детей маловероятные вещи делают вероятными. общие абстракции выдают за реальные вещи.
Вам-то, откуда знать, что там пишут в научпопе? Вы э нечего, кроме безграмотных креаброшюрок не читаете? :D 
Цитировать
Американцы сделали робкие попытки абиогенеза в лаборатории.
К сожалению, суть статьи, вы не смогли понять даже из научпоповского пересказа. Скорее всего просто не читали.
В статье не про абиогенез, статья выясняет могли ли быть первые клетки хемотрофами.
Цитировать
Ясно что абиогенез должен идти в малом пространстве протоклетки,
Сразу написали ерунду. Мембраны это уже эволюционное приобретение. Жизнь могла зарождаться в пористых глинах, о чем я уже докладывал.

Как мы видим, все ваше "стремление к невозможности" основано на лютом невежестве и нежелании разбираться в предмете.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 21.09.2020, 20:00:15
Мой тезис был, что с развитием цивилизации все легче идентифицировать орудия, как искусственные. Праща Давида это кусок кожи на веревке/лиане + камень вполне естественные ингредиенты. А вот про пушку, такого уже не скажешь.
Это говорит всего-навсего об увеличении громоздкости. Чем более громоздкую вещь сооружает человек, тем больше он оставляет в ней следов своего человеческого присутствия. Поэтому, разумеется, ее легче опознать как произведенную человеком.

Но отсюда совершенно не следует, что громоздкие и излишние решения, привнесенные столь же неразвитыми, как мы, представителями иной цивилизации, оказались бы хоть в чем-то похожими на наши пушки. Пример рассматривается в "Пикнике на обочине": вот, некое загадочное явление, а что - непонятно, то ли (совершенно естественное) разложение какой-нибудь неизвестной субстанции, то ли забытый кем-то "плюшевый медвежонок".
Голиаф жертва своего благородства. Поединщик вышел на честный бой, а ему залепили пращей.
К теме это не относится. Но ваше следующее предложение опровергает это. Голиаф был как раз представителем профессиональной армии, оснащенной наиболее современным оружием того времени - железными мечами и доспехами. Примерно как морпех.
Мог, но весь опыт колониальных войн показывает, что туземцы с гениальными пращами бессильны против морпехов с громоздкими орудиями.
Вы говорите о мощности, а я об эффективности: мощность, но соотнесенная с затратами на изготовление инструмента, его сложностью, универсальностью, долговечностью и так далее.

Если автомат Калашникова, условно говоря, в 10 раз мощнее ножа, то сложность его в тысячи раз больше. Поэтому морпехов и сегодня учат сражаться ножами. Вопрос эффективности!

Кстати говоря, наиболее смертноносное оружие, изобретенное на сей день, по сути своей не сложнее пращи. Это два куска урана, которые надо приложить один к другому. А другое столь же смертноносное оружие представляет собой... искусственно выведенные вирусы и бактерии, неотличимые от естественных.
Вы искусственный глаз сравниваете с дредноутом?
Корректно ли это?
Я не сравниваю, а привожу примеры, где ваши критерии искусственности "не работают".
Миллиарды лет, в принципе, не помеха, сегодня специалисты обнаруживают следы пребывания бактерий в породах 3,5 млр летней давности. А вы говорите про высокотехнологичную цивилизацию.
Вы запутались. Специалисты с огромным трудом обнаружили кое-какие следы живых организмов в очень древних породах. Буквально единичные следы, сохранившиеся благодаря счастливому случаю. Все прочие живые организмы, т.е. 99.999...% с огромным количеством девяток, не оставили никаких следов.

Собственно, чаще всего достаточно не миллиардов лет, а считанных сотен, чтобы то или иное человеческое поселение исчезло полностью вместе со всеми своими следами. Кроме, разве что, стран с засушливым климатом и поселений на горах, как в нашей стране - тут нужно немного больше времени. Поэтому каждое раскопанное поселение и представляет такую ценность для археологии.

Мы же говорим о предпожительном визите некоей сверхцивилизации, которая вовсе не собиралась основывать здесь поселений, а сконструировала первые прототипы одноклеточных организмов с ДНК (или привезла с собой, сконструировав еще у себя дома, что намного разумнее). Эта цивилизация могла засеять океаны этими организмами и улететь. Зачем им оставлять тут какие-то следы? Ну, может быть, выжженый круг от двигателей своего корабля, если у них (что маловероятно) столь же неэффективные двигатели, как у нас. И даже если бы они тут рахузабисто мусорили, устроив множество вечеринок с выпивкой и девочками, все равно от всего этого, скорее всего, не осталось бы следов уже через несколько тысяч лет - если исходить из практики современной археологии. Только вряд ли сверхцивилизация будет устраивать помойку на чужой планете...

Но, если следов агентов нет, а характер и количество находок колес не позволяют предположить, что это природные явления, то логично предположить, что колеса искусственные, тем более, что аналогия с человеческой технологией налицо.
Критерий искусственности в значении "произведено человеком" вопросов не вызывает. Но если то же самое колесо - каменный или металлический круг с дыркой посередине - будет обнаружено в космосе, то научная добросовестность заставит предположить, что оно возникло в результате каких-то естественных процессов, которые нам пока, возможно, неизвестны. Именно так произошло с пульсарами.

Нет, с ДНК ситуация совершенно иная. Искусственные предметы могут делать только живые разумные существа, иные агенты нам неизвестны. Если, мы находим колесо, то резонно предположить вмешательство разумного живого существа.
В случае с ДНК речь идет о появлении этих самых разумных живых существ. Допустим некие разумные живые существа могли запрограммировать и принести на землю ДНК. Но откуда они взялись сами?
Стоп, это уже совершенно иной, глубоко философский вопрос. При чем здесь критерии искусственности?

У нас есть затруднения конкретно с происхождением ДНК: неизвестны естественные процессы, которые могли бы привести к его появлению. Вполне возможно, что в случае иной формы жизни, которая и породила упомянутую сверхцивилизацию, дело обстоит иначе: их "генетический код" (если он вообще есть!) не вызывает подобных затруднений. А еще возможно энное количество вариантов. Прилетели из предыдущей Вселенной до Большого Взрыва, как в романе "Тау Зеро". Пришли из мира мертвых, преодолев границу жизни и смерти. Да что угодно! Нет никакого смысла обсуждать проблемы возникновения того, что нам неизвестно.

Так или иначе, мы упираемся в то, что жизнь должна была как-то где-то самозародится, поскольку о никаких сверхъестественных сущностях мы достоверными сведениями не располагаем.
Совсем непонятно. В огороде бузина, а в Киеве какие-то "сверхъестественные существа". Какое отношение имеет сверхъестественность к проблеме зарождения жизни? Если предположить фантастическую версию, что существует "сверхъестественная жизнь", то каким образом ее "сверхъестественность" помогает уйти от вопроса, как она зародилась?

Я вообще не понимаю, что вы имеете в виду под "сверхъестественностью". Все в мире существует и развивается по каким-то законам. Какие-то законы мы знаем, какие-то нет. Если мы кое-что (совсем немного) знаем об устройстве обезьяны, но ничего (пока) не знаем об устройстве ангелов или полтергейста, то какие причины называть одно естественным, а другое нет? Вирусы, например, были открыты совсем недавно, но разве до их открытия болезни, которые они вызывают, нужно было называть "сверхъестественными"?

Можно фантазировать, а можно искать самое простое решение и проверять его. Именно этот путь и привел нашу цивилизацию к тем техническим высотам, где мы и находимся.
Красивые слова, но при чем тут критерий искусственности? Поставлен вопрос: как, без фантазирования, привлечения древней истории или неизвестных нам научных фактов, установить, естественен данный предмет или искусственен? Что именно следует проверить в самом предмете?

Мне известен только один ответ, соответствующий тривиальному критерию: искусственное = произведено человеком. То, что произведено муравьями, гориллой Коко (https://ru.wikipedia.org/wiki/%D0%9A%D0%BE%D0%BA%D0%BE_(%D0%B3%D0%BE%D1%80%D0%B8%D0%BB%D0%BB%D0%B0)) или великой цивилизацией Андромеды, искусственным не называется. Точка.

В этом случае искусственность - это достаточное количество технологических ляпов и глупостей, внесенных в предмет благодаря неразумию изобретателя-человека. Чем совершеннее изделие человека, тем меньше в нем будет искусственности, а наиболее совершенные изобретения человека (корованирус? если все же правы сторонники этой идеи) вообще неотличимы от естественных.

Вы можете предложить что-то другое?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 21.09.2020, 20:52:34
Вы невнимательны. Какой там код, если речь идет о случайных последовательностях.Да? А кем и каким образом сказать сможете? ;)
ДНК это неслучайная последовательность наделёная функциональным смыслом.
Цитировать
Правда? Я-то, смогу показать того, кто нанес дырки на перфоленту, и смогу рассказать как он это сделал и зачем.
я тоже, человек разумный, руками. Я также могу показать, ссылаясь на доказательство разумного происхождения дырок на перфоленте, разумное происхождение ДНК. Вы можете мне показать человека разумного, автора этой глининой таблички? даю подсказку, отправляйтесь в прошлое с кинокамерой в древнюю Шумерию. 
(https://i.pinimg.com/originals/d3/dd/ac/d3ddac27c13535ac48325040a43c9cf0.jpg)
Цитировать
А вы? :)Вы можете повторять это утверждение пока hell freezes over, но до тех пор пока вы не продемонстрируете механизм интеграции "кода" непосредственно в "среде исполнения" и не докажете, что результаты работы ДНК обусловлены специфическим "кодом", а не естественными patterns, которые свойственны всем химическим соединениям, ваши утверждения обязаны быть и будут проигнорированы.Набор слов.
что такое механизм интеграции "кода"? механизм суммирования(объединения) кода? 

Физические динамические процессы подчинены принципу наименьшего действия, материальная точка будет стремится в то место пространства, где потенциальная энергия равна её значению по модулю кинетической энергии, а рельеф поверхности потенциальной ямы зависти от распределения в пространстве масс всех материальных точек. наименьшее действие вычисляется  где разность кинетической и потенциальной энергий интегрируется по времени.   А так как всё множество материальных точек движется в пространстве хаотично, рельеф потенциальной ямы постоянно меняется, точно также как хаотически меняются кинетические энергии всех материальных точек, поэтому все траектории материальных точек хаотичны. Законы химии достаточно точно определены в направлении протекания химических реакций, пример принцип комплементарности, вероятность образования комплементарных пар А-Т и С-Г равна 1, а А-С и Т-Г равна 0. Но мы говорим о малой вероятности физических законов, того что необходимый нуклеотид первым встроится в полинуклеотидную цепь и вероятность при благоприятных, искусственно созданных условиях внутри искусственной протоклетки равна 1/4, в естественных условиях она равна 1/8. Вы пытаетесь всё объяснить законами химии, не учитываете при этом законы физики их вероятностный характер. Чтобы все ваши химические законы заработали, законы физики должны были случайным образом создать эти самые физические феномены -  механизмы ДНК, АТФ, РНК и ферменты. Только в комплексе эти химические и физические молекулярные механизмы создают самовоспроизводящийся автомат с генетической программой и кодом.     
Цитировать
Мы будем иметь такую же определенную кислоту в результате естественных patterns. Согласны? А, если нет, то почему?
Паттерн понимается в этом плане как повторяющийся шаблон или образец. Элементы паттерна повторяются предсказуемо. В науке, в том числе в математике и языкознании, паттерны выявляются путём исследования.
Синтез ДНК идет в силу законов физики протекает спонтанно, мы не можем точно знать какой именно нуклеотид первым присоединиться к полинуклеотидной последовательности ДНК. Три случайно  присоединившийся последовательно нуклеотида ещё не означают, что это кодон кодирующий аминокислоту, есть некодирующие повторяющиеся последовательности. если мы хотим на выходе получить человека, то нам нужно чтобы случай выбрал правильный шаблон последовательности нуклеотидов ДНК, с вероятностью 1/8 для хирально грязной смеси нуклеотидов при условии что они равномерно распределены в растворе цитоплазмы протоклетки в равных пропорциях, что даёт наибольшую вероятность. Чтобы заработал шаблон нужно сначала создать механизмы работы шаблона, то есть весь минимальный набор ДНК кодирующие все элементы механизма клетки ферменты, РНК и АТФ, и весь набор необходимых ферментов и РНК в абиогенезе в пространстве протоклетки случайным способом должны быть случайно собраны. Когда всё создано, шаблон работает автоматически.     


Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 21.09.2020, 21:17:59
ДНК это неслучайная последовательность наделёная функциональным смыслом.
Что значит "неслучайная"? Чем случайное отличается от неслучайного?

вы можете мне показать человека разумного автора этой глининой таблички? даю подсказку отправляйтесь в прошлое с кинокамерой в древнюю Шумерию. 
(https://i.pinimg.com/originals/d3/dd/ac/d3ddac27c13535ac48325040a43c9cf0.jpg)
А как вы, в свою очередь, докажете, что эта табличка не появилась случайно? (Это и к Модесту Матвеевичу вопрос.)

Скажем, на Марсе чего только не "обнаружили", даже животных. См. https://astronews.ru/cgi-bin/mng.cgi?page=news&news=6992 или https://zelenyikot.livejournal.com/76631.html Эффект называется "парейдолия", и порой все очень убедительно:

(https://astronews.ru/news/2015/6992.jpg)
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 21.09.2020, 22:01:55
Что значит "неслучайная"? Чем случайное отличается от неслучайного?
если обезьяну посадить за компьютер и она что то настучала по клавиатуре типа:
рншеш43гщшрпкцутд8шгщаыьи, то что до запятой случайная последовательность, а после запятой неслучайная.
 

Скажем, на Марсе чего только не "обнаружили", даже животных. См. https://astronews.ru/cgi-bin/mng.cgi?page=news&news=6992 или https://zelenyikot.livejournal.com/76631.html Эффект называется "парейдолия", и порой все очень убедительно:

(https://astronews.ru/news/2015/6992.jpg)
игра света и тени + художественное воображение.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 22:04:34
Это говорит всего-навсего об увеличении громоздкости. Чем более громоздкую вещь сооружает человек, тем больше он оставляет в ней следов своего человеческого присутствия. Поэтому, разумеется, ее легче опознать как произведенную человеком.
Итак чем более развита цивилизация тем более громоздкие у нее пушки (условно говоря) тем легче отличить их от естественных образований. Вся история человеческих технологий это ярко демонстрирует.
Цитировать
Но отсюда совершенно не следует, что громоздкие и излишние решения, привнесенные столь же неразвитыми, как мы, представителями иной цивилизации, оказались бы хоть в чем-то похожими на наши пушки. Пример рассматривается в "Пикнике на обочине": вот, некое загадочное явление, а что - непонятно, то ли (совершенно естественное) разложение какой-нибудь неизвестной субстанции, то ли забытый кем-то "плюшевый медвежонок".
У сверхцивилизации следы еще более громоздкие, именно об этом "Пикник". Что там можно принять за естественное? Пустышки? Шар желаний? Зуду?
Цитировать
К теме это не относится. Но ваше следующее предложение опровергает это. Голиаф был как раз представителем профессиональной армии, оснащенной наиболее современным оружием того времени - железными мечами и доспехами. Примерно как морпех.
Что опровергает? Убить можно кого угодно. Как это опровергает весь колониализм?
Цитировать
Вы говорите о мощности, а я об эффективности: мощность, но соотнесенная с затратами на изготовление инструмента, его сложностью, универсальностью, долговечностью и так далее.
Если автомат Калашникова, условно говоря, в 10 раз мощнее ножа, то сложность его в тысячи раз больше. Поэтому морпехов и сегодня учат сражаться ножами. Вопрос эффективности!
С развитием цивилизации увеличивается и мощность и эффективность орудий. Это самоочевидные вещи.
Цитировать
Кстати говоря, наиболее смертноносное оружие, изобретенное на сей день, по сути своей не сложнее пращи. Это два куска урана, которые надо приложить один к другому. А другое столь же смертноносное оружие представляет собой... искусственно выведенные вирусы и бактерии, неотличимые от естественных.
Поинтересуйтесь какие приходится строить машины, что бы просто "приложить один к другому". Поинтересуйтесь насколько просто вывести новый боевой вирус. Праща, ага. ;D

Цитировать
Я не сравниваю, а привожу примеры, где ваши критерии искусственности "не работают".
Вы сравниваете протез с пароходом. И чему-то удивляетесь.
Цитировать
Вы запутались. Специалисты с огромным трудом обнаружили кое-какие следы живых организмов в очень древних породах. Буквально единичные следы, сохранившиеся благодаря счастливому случаю. Все прочие живые организмы, т.е. 99.999...% с огромным количеством девяток, не оставили никаких следов.
С чего вы решили, что единичные и благодаря случаю?
Факт, что можем различить следы бактерий через почти 4 миллиарда лет, а вы про сверхцивилизацию говорите...

Цитировать
Собственно, чаще всего достаточно не миллиардов лет, а считанных сотен, чтобы то или иное человеческое поселение исчезло полностью вместе со всеми своими следами. Кроме, разве что, стран с засушливым климатом и поселений на горах, как в нашей стране - тут нужно немного больше времени. Поэтому каждое раскопанное поселение и представляет такую ценность для археологии.
Бесследно ничего не исчезает.
Цитировать
Мы же говорим о предпожительном визите некоей сверхцивилизации, которая вовсе не собиралась основывать здесь поселений, а сконструировала первые прототипы одноклеточных организмов с ДНК (или привезла с собой, сконструировав еще у себя дома, что намного разумнее). Эта цивилизация могла засеять океаны этими организмами и улететь. Зачем им оставлять тут какие-то следы? Ну, может быть, выжженый круг от двигателей своего корабля, если у них (что маловероятно) столь же неэффективные двигатели, как у нас. И даже если бы они тут рахузабисто мусорили, устроив множество вечеринок с выпивкой и девочками, все равно от всего этого, скорее всего, не осталось бы следов уже через несколько тысяч лет - если исходить из практики современной археологии. Только вряд ли сверхцивилизация будет устраивать помойку на чужой планете...
Это фантазии. Весь наш опыт говорит о том, что цивилизация оставляет следы. Будут следы, будет предмет для разговора.
Цитировать
Критерий искусственности в значении "произведено человеком" вопросов не вызывает
.
А другого критерия нет, поскольку другие разумные агенты не известны.

Цитировать
Но если то же самое колесо - каменный или металлический круг с дыркой посередине - будет обнаружено в космосе, то научная добросовестность заставит предположить, что оно возникло в результате каких-то естественных процессов, которые нам пока, возможно, неизвестны. Именно так произошло с пульсарами.
К колесу мы спокойно применяем человеческую аналогию, колесо предмет известный. А природа в производстве колес замечена пока не была.

Цитировать
Стоп, это уже совершенно иной, глубоко философский вопрос. При чем здесь критерии искусственности?
У нас есть затруднения конкретно с происхождением ДНК: неизвестны естественные процессы, которые могли бы привести к его появлению.

Почему неизвестны? Я приводил научные работы с гипотезами.
Цитировать
Вполне возможно, что в случае иной формы жизни, которая и породила упомянутую сверхцивилизацию, дело обстоит иначе: их "генетический код" (если он вообще есть!) не вызывает подобных затруднений. А еще возможно энное количество вариантов. Прилетели из предыдущей Вселенной до Большого Взрыва, как в романе "Тау Зеро". Пришли из мира мертвых, преодолев границу жизни и смерти. Да что угодно! Нет никакого смысла обсуждать проблемы возникновения того, что нам неизвестно.
Это опять фантазии.
Жизнь на основе нашего кода нам известна, поэтому мы можем о ней говорить. Вполне логично предположить, что если в прошлом существовала планета подобная Земле, на ней могла появится и жизнь и цивилизация, которая могла занести жизнь и на нашу планету. Такая гипотеза оперирует только известными сущностями, а вы начинаете неуемно фантазировать.
Цитировать
Совсем непонятно. В огороде бузина, а в Киеве какие-то "сверхъестественные существа". Какое отношение имеет сверхъестественность к проблеме зарождения жизни? Если предположить фантастическую версию, что существует "сверхъестественная жизнь", то каким образом ее "сверхъестественность" помогает уйти от вопроса, как она зародилась?
Очень просто. Вот спросите у Александра, он вам ответит - все создал Бог, и думать ничего не надо.
Цитировать
Я вообще не понимаю, что вы имеете в виду под "сверхъестественностью". Все в мире существует и развивается по каким-то законам. Какие-то законы мы знаем, какие-то нет. Если мы кое-что (совсем немного) знаем об устройстве обезьяны, но ничего (пока) не знаем об устройстве ангелов или полтергейста, то какие причины называть одно естественным, а другое нет? Вирусы, например, были открыты совсем недавно, но разве до их открытия болезни, которые они вызывают, нужно было называть "сверхъестественными"?
Я имею в виду тоже, что и все:
Сверхъесте́ственное — мировоззренческая категория, которая определяет то, что находится «над» физическим миром измерений и действует вне влияния законов природы, выпадает из цепи причинных связей и зависимостей, нечто первичное по отношению к реальности и воздействующее на неё
Сверхъестественное (https://ru.wikipedia.org/wiki/%D0%A1%D0%B2%D0%B5%D1%80%D1%85%D1%8A%D0%B5%D1%81%D1%82%D0%B5%D1%81%D1%82%D0%B2%D0%B5%D0%BD%D0%BD%D0%BE%D0%B5)
Цитировать
Красивые слова, но при чем тут критерий искусственности? Поставлен вопрос: как, без фантазирования, привлечения древней истории или неизвестных нам научных фактов, установить, естественен данный предмет или искусственен? Что именно следует проверить в самом предмете?
А почему вы древнюю историю отсекаете?
Цитировать
Мне известен только один ответ, соответствующий тривиальному критерию: искусственное = произведено человеком. То, что произведено муравьями, гориллой Коко (https://ru.wikipedia.org/wiki/%D0%9A%D0%BE%D0%BA%D0%BE_(%D0%B3%D0%BE%D1%80%D0%B8%D0%BB%D0%BB%D0%B0)) или великой цивилизацией Андромеды, искусственным не называется. Точка.
Согласен.
Цитировать
В этом случае искусственность - это достаточное количество технологических ляпов и глупостей, внесенных в предмет благодаря неразумию изобретателя-человека. Чем совершеннее изделие человека, тем меньше в нем будет искусственности, а наиболее совершенные изобретения человека (корованирус? если все же правы сторонники этой идеи) вообще неотличимы от естественных.
А вот это ерунда. Возвращаемся к началу. Корабельное орудие это вовсе не набор "ляпов и глупостей", которые внесли в пращу. Что бы получить новый вирус нужно построить огромные комплексы машин, которые никак невозможно принять за естественные. Человек все более и более перестраивает под себя планету следов все больше и больше, где оно естественное? Ау?

Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 21.09.2020, 22:26:51
ДНК это неслучайная последовательность наделёная функциональным смыслом.
Вы не имеете привычки вчитываться в разговор, куда влезаете? Не?
речь шла чем случайная последовательность дырок на перфоленте может походить на случайную последовательность триплет-кодонов в ДНК. 

Цитировать
Вы можете мне показать человека разумного, автора этой глининой таблички? даю подсказку, отправляйтесь в прошлое с кинокамерой в древнюю Шумерию. 
Абсолютно незачем. Существуют бесчисленные археологические, антропологические и тд находки из той местности и того времени. У нас нет никаких проблем сопоставить факт наличия останков людей и следов материальной культуры, в частности этой таблички.
Цитировать
Чтобы все ваши химические законы заработали, законы физики должны были случайным образом создать эти самые физические механизмы ДНК, АТФ, РНК и ферменты. Только в комплексе эти химические и физические молекулярные механизмы создают самовоспроизводящийся автомат с генетической программой и кодом. 
Вы все никак не можете понять, что "самовоспроизводящийся автомат с генетической программой и кодом" есть продукт долгой эволюции. Совершенно незачем было случайно организовываться всему сразу, хотя никакими законами это не запрещено.
 
Цитировать
  Паттерн понимается в этом плане как повторяющийся шаблон или образец.
в разных областях понятие "pattern" имеет различные значения, но в науке оно означает повторяющиеся и предсказуемые естественные конфигурации.

Цитировать
Элементы паттерна повторяются предсказуемо. В науке, в том числе в математике и языкознании, паттерны выявляются путём исследования.
Синтез ДНК идет в силу законов физики спонтанно, мы не можем точно знать какой нуклеотид первым присоединиться к полинуклеотидной последовательности ДНК.
Что еще за "синтез ДНК"? Репликация?
Цитировать
три случайно  присоединившийся последовательно нуклеотида ещё не означают что это кодон кодирующий аминокислоту, есть некодирующие повторяющиеся последовательности. если мы хотим на выходе получить человека, нам нужно чтобы случай выбрал правильный шаблон последовательности нуклеотидов ДНК, с вероятностью 1/8 для хирально грязной смеси нуклеотидов при условии что они равномерно распределены в растворе цитоплазмы протоклетки в равных пропорциях, что баёт наибольшую вероятность.

Откуда у вас человек и протоклетка?
Что за дичь? :o

Цитировать
Чтобы заработал шаблон нужно сначала создать механизмы работы шаблона, то есть весь минимальный набор ДНК колирующие все элементы механизма ферменты, РНК и АТФ, и весь набор необходимых ферментов и РНК в абиогенезе в пространстве протоклетки случайным способом. Когда всё создано шаблон работает автоматически.     
А что такое минимальный набор ДНК? :)

Теорий появление генетического кода более чем, ничего невероятного в этом нет. Одну из них я даже вам давал почитать:
Происхождение белкового синтеза и генетического кода (https://istina.msu.ru/media/publications/article/13d/fbb/7360574/2013_07_20-23.pdf)
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 21.09.2020, 22:27:21
(https://avatars.mds.yandex.net/get-zen_doc/1222384/pub_5ef3b823f41f8c0d161b63a9_5ef3c2ba99d22e15460a1ada/scale_1200)
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 22.09.2020, 01:49:19
если обезьяну посадить за компьютер и она что то настучала по клавиатуре типа:
рншеш43гщшрпкцутд8шгщаыьи, то что до запятой случайная последовательность, а после запятой неслучайная.
Это пример, а не ответ на вопрос. Очевидно, движения обезьяны, если оно здорова, были как-то скоординированы, и такая последовательность букв получилась в результате того, что обезьяна именно так двигала рукой. Отличие не в том, что последовательность "случайна", а в том, что обезьяна не знала, как набирать правильно - и набрала как-то.

Между прочим, в том, что набирала обезьяна, почти наверняка будет закономерность. Скажем, она будет бить все время по одним и тем же клавишам, будут часто набираться соседние клавиши и так далее. Если вы когда-нибудь видели, как малыш, не умеющий играть на пианино, развлекается за клавиатурой, то должны были заметить - получаемые звуки вполне упорядочены, просто неблагозвучны.

Добавлю к этому, что в мире вообще все неслучайно, ибо происходит по воле Творца - даже волос, падающий с головы. Истинно случайными, быть может, можно назвать квантовые эффекты, но это отдельный сложный вопрос.

игра света и тени + художественное воображение.
Очевидно, я в курсе, раз дал вам эту ссылку :) Вопрос был в другом: чем в принципе отличаются эти "результаты игры света и тени" от реальной искусственной таблички с древним текстом? Можете ли вы предложить какой-то алгоритм или метод, следуя которому, человек (или компьютер), анализируя эти картинки, сможет уверенно заявить: вон тот "псевдо-динозавр" получился случайно, а вот этот текст на табличке явно создан целенаправленно?
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 22.09.2020, 02:42:54
Очевидно, начать надо с того, что вы согласились с моим основным тезисом: никакого критерия искусственности придумать невозможно. Можно лишь назвать искусственным то, что произведено человеком, и затем проверять гипотезу, действительно ли человек в этом участвовал.

О чем же мы тогда спорим? В этом случае тема вырождается в тривиальщину, и вроде бы спорить решительно не о чем. Разумеется, человек не проектировал ДНК. Но и любые действительно интересные споры ученых о том, имеют ли те или иные космические сигналы искусственное происхождение, на таком языке невозможно сформулировать. Разумеется, любые сигналы из дальнего космоса не имеют отношения к человеку и в этой терминологии естественны. Даже если на Красной площали приземлится инопланетный космический корабль - он естественен, так как человеком не произведен.

По поводу нюансов можно поговорить.
Итак чем более развита цивилизация тем более громоздкие у нее пушки (условно говоря) тем легче отличить их от естественных образований. Вся история человеческих технологий это ярко демонстрирует.
Не вижу, чтобы технологии двигались только по пути громоздкости. Да, это наиболее легкий путь чего-то добиться - нагромоздить достаточную кучу деталей. Но бывают и гениальные изобретения. Бывает и постепенное совершенствование, когда предмет постепенно избавляется от излишней громоздкости. Сравните БЭСМ-6 и сотовый телефон.

У сверхцивилизации следы еще более громоздкие, именно об этом "Пикник". Что там можно принять за естественное? Пустышки? Шар желаний? Зуду?
Стругацкие, в отличие от Лема, не ставили задачи построить действительно правдоподобную модель иной цивилизации. Их роман о другом. Но, честно говоря, особой громоздкости в этих артефактах я не заметил - они структурно проще, чем большинство наших инструментов. А такие вещи, как "мясорубка", "ведьмин студень", "жгучий пух", "комариная плешь" и так далее вообще сложно отнести к естественному или искусственному, если исходить из человеческих параллелей.

Собственно, даже про шар желаний трудно сказать что-то определенное. Ну шар. Ну золотистый. Ну, желания исполняет. И с какой стати надо считать, что это искусственный предмет? Естественные шары тоже бывают. Может, это животное такое, умное и круглое, которое они привезли со своей планеты и которое умеет исполнять чужие желания с помощью телепатии, телепортации и прочих научно-фантастических фокусов.

Что опровергает? Убить можно кого угодно. Как это опровергает весь колониализм?
Э... вы окончательно запутались :)

С развитием цивилизации увеличивается и мощность и эффективность орудий. Это самоочевидные вещи.
Когда вещь трудно обосновать, проще всего ее назвать "самоочевидной" :)
Я не согласен и аргументировал свою позицию. Пушка мощнее лука и стрел. Но гораздо менее эффективна.

Поинтересуйтесь какие приходится строить машины, что бы просто "приложить один к другому".
Скорее, для того, чтобы случайно не бабахнуло.
Поинтересуйтесь насколько просто вывести новый боевой вирус. Праща, ага. ;D
Праща - это не просто праща. Это праща + человеческая рука и человеческий мозг, позволяющие ей эффективно воспользоваться.

Вирус, в отличие от пращи, работает автономно от человека. Поэтому, да, создать его гораздо сложнее. Но... возможно. И это тоже пример совершенства, только "на другом конце шкалы".

Простите, вы как будто идете по поверхности диалога, не замечая главного. Вы же согласны, что боевой вирус искусственен. Но при этом он неотличим от естественного!

Вам, с вашей терминологией, придется присвоить тому же коронавирусу статус "естественный" или "искусственный" не на основании свойств этого вируса, а только по результатам детективных расследований. Если докажут, что его разработали в такой-то лаборатории, то он окажется "искусственным", если докажут обратное, то "естественным", а может быть, вопрос так и повиснет в воздухе.

И зачем тогда вообще нужен такой термин? Тогда надо говорить не "искусственный", а "искусственного происхождения (в скобках - произведено человеком)".

Факт, что можем различить следы бактерий через почти 4 миллиарда лет, а вы про сверхцивилизацию говорите...
Бесследно ничего не исчезает. Это фантазии. Весь наш опыт говорит о том, что цивилизация оставляет следы. Будут следы, будет предмет для разговора..
Что-то вы снова все пропустили... Ну, поставьте эксперимент. Бросьте где-нибудь в лесу, подальше от города, какие-нибудь предметы искусственного происхождения. Книжку там, телефон, кочергу. А потом попробуйте их там отыскать лет через десять. Зачем ждать тысячу...

Даже такие значительные артефакты, как асфальтовые дороги, разрушаются дождями и солнцем довольно быстро. Бывает, конечно, долговечный мусор, но это относительная "долговечность" - могут потребоваться упомянутые тысячи лет. А за миллионы лет почти наверняка произойдет какое-нибудь землетрясение, наступление ледников или извержение вулкана, так что даже гигантские каменные постройки вроде пирамид с вероятностью 99.999...% исчезнут бесследно.

При этом очевидно же, что если ДНК и правда проектировала какая-то сверхцивилизация, то, в отличие от самолюбимых фараонов, она не ставила цели оставить внешние следы, а наоборот, скорее всего, работала аккуратно. Прилетели, что-то сделали, прибрались за собой и улетели. Примерно так работает любая научная экспедиция, скажем, геофизики в том же лесу (я однажды был в такой экспедиции). Поверьте, при всей важности и масштабности этой работы, никаких особенных следов, которые потом можно обнаружить, экспедиция не оставляет - разве что колеи от колес и случайно забытый кем-то мусор. Но через очень небольшое время - годы, десятилетия, максимум столетия - на том болоте, где мы работали, никаких следов не останется.

А если бы, в свою очередь, они действительно хотели оставить следы, то оставили бы их на Луне - какую-нибудь многокилометровую пирамиду из золота или что-нибудь подобное.
Очень просто. Вот спросите у Александра, он вам ответит - все создал Бог, и думать ничего не надо.
Правильно, не надо. Если все создал Бог, если в этом не участвовала никакая цивилизация, то, разумеется, ДНК естественны. Равно как песок и камни, люди и цветы, нейтронные звезды и кварки. Бог потому и Бог (а не человек и не бог), что является создателем абсолютно всей естественной природы!

Тем не менее, вопрос остается. Ведь, кроме Бога, есть Его дети - разумные существа. И вот как раз результаты их работы уместно назвать искусственными.

Сверхъесте́ственное — мировоззренческая категория, которая определяет то, что находится «над» физическим миром измерений и действует вне влияния законов природы, выпадает из цепи причинных связей и зависимостей, нечто первичное по отношению к реальности и воздействующее на неё
Это, вообще говоря, объяснение неизвестного через непонятное. Веревка есть вервие простое.

Что значит "над"? А если "под" (ад), то не пойдет? Законы природы - а что называется природой? Внутренние органы ангелов - это природа или нет? Или это не природа до тех пор, пока ни один ученый ангела не ощупал, а после этого станет называться природой? Что значит "выпадает из причинной цепи"? Наверно, черти и ангелы тут ни при чем, ведь их действия логичны и имеют свои причины - похоже, автор имел в виду самопроизвольный распад нейтрона... И, наконец, что значит "первичное по отношению к реальности"? Эти "сверхъестественные" существа либо реальны, либо нет. В первом случае они не первичны, во втором - их вообще нет, соответственно, воздействовать на реальность просто некому. Наконец, при сопоставлении ангелов, языческих божеств и подобных созданий с человеком первичным, по Библии, окажется человек, а не они. Важнее человека на Земле только Бог, а Он как раз отличается тем, что, как ни странно, вообще никаких законов природы не нарушает и за их рамки не выходит. Вместо этого, Он эти законы разрабатывает.

В общем, это больше претензия на объяснение, набор популярных ключевых слов, чем настоящий анализ понятия.

А почему вы древнюю историю отсекаете?
Потому, что хочу обсуждать нетривиальные вопросы, а не тавтологии. Разумеется, если, как вы предложили, называть искусственным то, что произведено человеком, то для выяснения искусственности нужно историческое расследование, а не изучение самого предмета. Или не нужно, если данное явление старше самого человечества.

Но тема для обсуждения при этом автоматически исчезает.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 22.09.2020, 03:46:52
О том, что в ДНК есть код подсказка Артёма:

«The main reason for this is that modern biology assumes that signs and meanings do not exist at the molecular level, and that the genetic code was not followed by any other organic code for almost four billion years, which implies that it was an utterly isolated exception in the history of life. These ideas have effectively ruled out the existence of semiosis in the organic world, and yet there are experimental facts against all of them. If we look at the evidence of life without the preconditions of the present paradigm, we discover that semiosis is there, in every single cell, and that it has been there since the very beginning. This is what biosemiotics is really about. It is not a philosophy. It is a new scientific paradigm that is rigorously based on experimental facts. Biosemiotics claims that the genetic code (1) is a real code and (2) has been the first of a long series of organic codes that have shaped the history of life on our planet. The reality of the genetic code and the existence of other organic codes imply that life is based on two fundamental processes--copying and coding--and this in turn implies that evolution took place by two distinct mechanisms, i.e., by natural selection (based on copying) and by natural conventions (based on coding)».

«These entities are as real as physical quantities in the sense that they are equally necessary to the description of biological systems, and this means that in no way can we dismiss them as linguistic metaphors».

«...we have seen that biosemiotics has been developed independently by at least five different lines of research. One is the Sebeok–Hoffmeyer approach that is based on Peirce’s definition of sign and assumes that interpretation is a fundamental feature of semiosis. The second is the organic-codes line of research where semiosis is based on coding, not on interpretation, and the other three are the approaches developed respectively by Gregory Bateson, Howard Pattee, and Anton Markoš. This makes us realize that biosemiotics is still a developing science where many issues, even important ones, remain to be settled.

All versions of biosemiotics, at any rate, share the idea that semiosis is fundamental to life, i.e., that all living creatures are semiotic systems, and the important point is that we already have enough experimental evidence in favor of that idea. Biosemiotics, in conclusion, is a genuine new paradigm for both biology and semiotics, but its future is unpredictable. It truly is like a new continent whose exploration has just began».

Barbieri M. Biosemiotics: a new understanding of life.
Link: https://www.ncbi.nlm.nih.gov/pubmed/18365164/



Основная причина этого заключается в том, что современная биология предполагает, что знаки и значения не существуют на молекулярном уровне, и что генетический код не сопровождался никаким другим органическим кодом в течение почти четырех миллиардов лет, что означает, что он был полностью изолированным. исключение в истории жизни. Эти идеи фактически исключили существование семиозиса в органическом мире, но все же существуют экспериментальные факты против всех них. Если мы посмотрим на свидетельства жизни без предварительных условий настоящей парадигмы, мы обнаружим, что семиозис присутствует в каждой отдельной клетке, и что он был там с самого начала. В этом суть биосемиотики. Это не философия. Это новая научная парадигма, строго основанная на экспериментальных фактах. Биосемиотика утверждает, что генетический код (1) является настоящим кодом и (2) был первым из длинной серии органических кодов, которые сформировали историю жизни на нашей планете. Реальность генетического кода и существование других органических кодов подразумевает, что жизнь основана на двух фундаментальных процессах - копировании и кодировании - а это, в свою очередь, означает, что эволюция происходила с помощью двух различных механизмов, то есть путем естественного отбора (на основе о копировании) и по естественным соглашениям (на основе кодирования) ». «Эти сущности так же реальны, как и физические величины, в том смысле, что они одинаково необходимы для описания биологических систем, а это означает, что мы никоим образом не можем отбрасывать их как лингвистические метафоры». «... мы увидели, что биосемиотика была разработана независимо, по крайней мере, в пяти различных направлениях исследований. Один из них - это подход Себека-Хоффмейера, который основан на определении знака Пирсом и предполагает, что интерпретация является фундаментальной особенностью семиозиса. Второй - это направление исследований органических кодов, в котором семиозис основан на кодировании, а не на интерпретации, а остальные три - это подходы, разработанные соответственно Грегори Бейтсоном, Говардом Патти и Антоном Маркошем. Это заставляет нас понять, что биосемиотика - все еще развивающаяся наука, в которой еще предстоит решить многие, даже важные, вопросы. Во всяком случае, все версии биосемиотики разделяют идею о том, что семиозис является фундаментальным для жизни, т. Е. Что все живые существа являются семиотическими системами, и важно то, что у нас уже есть достаточно экспериментальных данных в пользу этой идеи. В заключение, биосемиотика - это действительно новая парадигма как для биологии, так и для семиотики, но ее будущее непредсказуемо. Это действительно похоже на новый континент, освоение которого только начинается ».
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 22.09.2020, 03:48:54
Что такое биология кода?
Marcello Barbieri 1

PMID: 28993248 DOI: 10.1016 / j.биосистемы.2017.10.005
Абстрактный
Различные независимые открытия показали, что многие органические коды существуют в живых системах, и это означает, что они возникли в течение истории жизни и внесли свой вклад в эту историю. Генетический код появился в популяции примитивных систем, которая была названа общим предком, и было высказано предположение, что три различных кода обработки сигналов дали начало трем первичным царствам архей, бактерий и Эукарий. С другой стороны, после генетического кода и кодов обработки сигналов только предки эукариот продолжали исследовать кодирующее пространство и дали начало кодам сплайсинга, гистоновому коду, тубулиновому коду, компартментным кодам и многим другим. Первым теоретическим следствием этого исторического факта является идея о том, что Эукарии становились все более сложными, поскольку они сохраняли потенциал для появления новых органических кодов. Второе теоретическое следствие вытекает из того, что эволюция отдельных правил кода может занять чрезвычайно много времени, но возникновение нового органического кода соответствует появлению полного набора правил, и с геологической точки зрения это равносильно внезапному событию. Иными словами, большие разрывы в истории жизни можно объяснить появлением новых кодов. Третье теоретическое следствие вытекает из того факта, что органические коды были высоко сохранены в эволюции, что показывает, что они являются великими инвариантами жизни, единственными сущностями, которые оставались нетронутыми в течение миллиардов лет, в то время как все остальное изменилось. Это говорит нам о том, что органические коды являются фундаментальными компонентами жизни, и их изучение - новая область исследований биологии кодов - должно стать все более актуальной частью наук о жизни.

Ключевые слова: Клеточная организация; общий предок; сложность; эукариоты; макроэволюция; органические коды; прокариоты.
https://pubmed.ncbi.nlm.nih.gov/28993248/
Copyright © 2017 Elsevier B. V. Все права защищены.

Органические коды. Основной механизм макроэволюции
М Барбьери 1

Абстрактный
Происхождение генетического кода совпало с возникновением жизни, в то время как человеческие коды культурной эволюции появились почти четыре миллиарда лет спустя. Современная биология не признает никакого другого органического кода в природе и поэтому вынуждена заключить, что вся клеточная эволюция состояла из информационных изменений. Семантические преобразования, естественные условности и биологический смысл-это вещи, которые официально не существуют в органическом мире и не играют никакой роли в нашей реконструкции развития и эволюции. И все же свойства органических кодов начинают проявляться в различных биологических процессах. Здесь показано, что сплайсинг, трансдукция сигналов и формирование паттернов могут быть объяснены именно наличием органических кодов. Показано также, что эти процессы способствовали значительным изменениям в истории жизни, и сделан вывод о том, что каждый основной шаг макроэволюции соответствовал возникновению нового органического кода.
https://pubmed.ncbi.nlm.nih.gov/10212570/

Общая модель происхождения биологических кодов
Marcello Barbieri 1

PMID: 31004696 DOI: 10.1016 / j.биосистемы.2019.04.010
Абстрактный
Долгое время считалось, что правила генетического кода определяются химией - либо стереохимическим сродством, либо метаболическими реакциями, - но экспериментальные данные показали совершенно иную реальность; было показано, что любой кодон может быть связан с любой аминокислотой, и это означает, что между ними нет детерминированной связи. Другими словами, генетический код основан на произвольных, или условных, правилах, и это ставит огромную проблему: как могут существовать произвольные правила в природе? Мы знаем, что такие правила существуют в культуре, но существует огромная разница между биологией и культурой, потому что культурные коды недолговечны, в то время как биологические коды являются наиболее сохраняемыми сущностями в эволюции. Биологические коды, другими словами, принципиально отличаются от культурных кодов, и нам нужна модель, позволяющая понять, как они возникли. В данной работе показано, что зарождение биологических кодов происходит в пять фаз (начало, эволюция, оптимизация, главный переход и сохранение), что позволяет предложить общую модель их развития. Согласно этой модели, биологический код развивается в системе как средство решения локальной проблемы, но затем он становится инструментом гораздо более масштабных изменений в макроэволюции. В этом и заключается огромный потенциал биологических кодов: их способность привносить в жизнь абсолютные новшества, меняющие весь ход истории жизни. Различные основные переходы были основаны на различных кодах, но мы также можем распознать некоторые общие черты во всех них. Это указывает на то, что кодирование является универсальным механизмом, который природа использовала много раз в ходе эволюции для решения широкого спектра различных проблем.

Ключевые слова: Произвольность; двусмысленность кода; сохранение кода; оптимизация кода; культурные коды; основные переходы; нейронные коды; органические коды.
https://pubmed.ncbi.nlm.nih.gov/31004696/
Copyright © 2019 Elsevier B. V. Все права защищены.

Эволюция генетического кода: теория уменьшения неоднозначности
Marcello Barbieri 1

PMID: 31499094 DOI: 10.1016 / j.биосистемы.2019.104024
Абстрактный
Экспериментальные данные показали, что генетический код основан на произвольных, или условных, правилах, в том смысле, что любой кодон может быть связан с любой аминокислотой, и это означает, что между ними нет детерминированной связи. Это резко контрастирует с традиционной парадигмой стереохимической теории, которая утверждает, что правила генетического кода были определены химией, а точнее стереохимическим сродством между кодонами и аминокислотами. Открытие, что генетический код основан на произвольных правилах, с другой стороны, подняло огромную проблему: как такие правила могут существовать в природе? Чтобы решить эту проблему, было указано, что правила произвольного кода не могли полностью сформироваться. Иными словами, первый генетический код был неизбежно двусмысленным, и его эволюция происходила с помощью механизма, который систематически уменьшал его двусмысленность и в конечном счете устранял ее. Понятие редукции двусмысленности неоднократно упоминалось в научной литературе, но лишь в очень немногих работах фактически рассматривалась проблема ее механизма. Одна из этих работ была опубликована под названием "рибосомно-ориентированная модель", чтобы подчеркнуть ключевую роль, которую рибосомные белки играют в этом процессе, но позже стало ясно, что необходимо учитывать и другие факторы. Вот почему модель, ориентированная на рибосомы, должна была быть расширена, и здесь предлагается более общая версия под названием теории уменьшения неоднозначности.

Ключевые слова: Адаптеры; биологическая специфичность; неоднозначность кода; произвольность кода; минимизация ошибок; генетический код; рибосомы; статистические белки; Стереохимическая теория.
https://pubmed.ncbi.nlm.nih.gov/31499094/
Copyright © 2019 Elsevier B. V. Все права защищены.

Вероятная связь между разбиениями набора кодонов и происхождением генетического кода
Дино Г Салинас 1, Mauricio O Gallardo 2, Мануэль I Осорио 3

PMID: 24495914 DOI: 10.1016 / j.биосистемы.2014.01.007
Абстрактный
Здесь мы изучаем распределение случайно сгенерированных разделов набора кодонов, кодирующих аминокислоты. Некоторые результаты представляют собой приложение из предыдущей работы о числах Стирлинга второго рода и триплетных кодах, как к случаям триплетных кодов, имеющих четыре стоп-кодона, как в митохондриальном генетическом коде млекопитающих, так и к гипотетическим дублетным кодам. Расширяя предыдущие результаты, в настоящей работе установлено, что наиболее вероятное число блоков синонимичных кодонов в генетическом коде аналогично числу аминокислот при наличии четырех стоп-кодонов, а также могло бы быть для первичного дублетного кода. Также изучаются целочисленные разбиения, связанные с паттернами синонимичных кодонов, и показано, что для канонического кода стандартное отклонение внутри целочисленного разбиения является одним из наиболее вероятных. Мы думаем, что в некую раннюю эпоху генетический код мог иметь максимум беспорядка или энтропии, независимо от назначения между кодонами и аминокислотами, достигая состояния, подобного "замораживанию кода", предложенному Фрэнсисом Криком. На более поздних стадиях, возможно, детерминированные правила переназначили кодоны аминокислотам, формируя естественные коды, такие как канонический код, но сохраняя числовые признаки, описывающие множество разделов и целочисленные разделы, такие как "ископаемые числа"; оба вида разделов о множестве кодирующих аминокислоты кодонов.

Ключевые слова: Энтропия; эволюция; генетический код; целочисленное разбиение; происхождение; числа Стирлинга второго рода.
https://pubmed.ncbi.nlm.nih.gov/24495914/
Copyright © 2014 Elsevier Ireland Ltd. Все права защищены.

Наиболее вероятное число блоков для разбиения набора кодонов могло бы определить количество стандартных аминокислот
Дино Г Салинас 1, Mauricio O Gallardo, Manuel I Osorio

PMID: 22426028 DOI: 10.1016 / j.биосистемы.2012.02.007
Абстрактный
Учитывая генетический код, образованный 64 кодонами, мы вычисляем число разделов набора кодирующих аминокислотных кодонов. При наличии 0-3 стоп-кодонов результаты показывают, что наиболее вероятное число секций равно 19 и/или 20. Затем, предполагая, что в ранней эволюции генетический код мог иметь случайные вариации, мы предполагаем, что наиболее вероятное число разбиений набора кодирующих аминокислот кодонов определяло фактическое число 20 стандартных аминокислот.
https://pubmed.ncbi.nlm.nih.gov/22426028/
Copyright © 2012 Elsevier Ireland Ltd. Все права защищены.

Расширенный код РНК и его связь со стандартным генетическим кодом: алгебраический и геометрический подход
Marco V Jose 1, Эберто Р. Моргадо, Ципе Говезенский
 
PMID: 17080285 DOI: 10.1007/s11538-006-9119-3
Абстрактный
Алгебраический и геометрический подход используется для описания первичного кода РНК и предлагаемого расширенного кода РНК. Первый состоит из всех кодонов типа RNY, где R означает пурины, Y пиримидины и N любой из них. Последний содержит 16 кодонов типа RNY плюс кодоны, полученные при рассмотрении кода РНК, но во второй (тип NYR) и третьей (тип YRN) кадрах считывания. В каждой из этих систем отсчета есть 16 триплетов, которые в целом завершают набор из 48 триплетов, которые определяют 17 из 20 аминокислот, включая AUG, начальный кодон и три известных стоп-кодона. Остальные 16 кодонов не относятся к расширенному коду РНК и представляют собой объединение триплетов YYY и RRR, которые мы определяем как код без РНК. Кодоны в каждом из трех подмножеств расширенного кода РНК представлены четырехмерным гиперкубом, а набор кодонов кода без РНК представлен в виде четырехмерной гиперпризмы. Примечательно, что объединение этих четырех симметричных попарно непересекающихся множеств точно включает уже известный шестимерный гиперкуб стандартного генетического кода (SGC) из 64 триплетов. Эти результаты позволяют предположить вероятный эволюционный путь, по которому первобытный РНК-код мог породить SGC, через расширенный РНК-код плюс код без РНК. Мы утверждаем, что жизненные формы, которые, вероятно, подчинялись расширенному коду РНК, были промежуточными между Рибо-организмами мира РНК и последним общим предком (LCA) прокариот, архей и Эвкарий, т. е. Также выводится общая кодирующая функция E, которая сопоставляет каждый кодон с соответствующей аминокислотой или сигналом остановки. В 45 из 64 случаев эта функция принимает форму линейного преобразования F, которое проецирует весь шестимерный гиперкуб на четырехмерную гиперповерхность, соответствующую всем триплетам, которые заканчиваются в цитозине. В остальных 19 случаях функция е принимает форму аффинного преобразования, т. е. композиции F с определенным переводом. Графические представления четырех локальных функций кодирования и E иллюстрируются и обсуждаются. Для каждой аминокислоты и для стоп-сигнала в качестве канонического представителя выбирается один триплет из числа тех, которые его определяют. Из этого отображения также выводится графическое представление 20 аминокислот и стоп-сигнала. Мы приходим к выводу, что общая функция кодирования E представляет собой саму SGC.

https://pubmed.ncbi.nlm.nih.gov/17080285/



Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 22.09.2020, 04:11:55
Коды и информация для исправления ошибок в биологии
Gérard Battail 1
https://pubmed.ncbi.nlm.nih.gov/31295534/
PMID: 31295534 DOI: 10.1016 / j.биосистемы.2019.103987
Абстрактный
Теорема Шеннона о канальном кодировании (1948), главный результат теории информации, парадоксально утверждает, что безошибочная связь возможна с использованием ненадежного канала. С тех пор инженеры разработали множество исправляющих ошибки кодов и алгоритмов декодирования. Показатели, близкие к прогнозируемым, в конечном итоге были достигнуты не ранее начала девяностых годов. Многие средства связи не могли бы существовать без исправляющих ошибки кодов, например, мобильная телефония и наземное цифровое телевидение. В этой статье сначала объясняется, как они работают без математического формализма. Код исправления ошибок-это миноритарное подмножество среди некоторого набора сообщений. В пределах этого подмножества сообщения достаточно отличаются друг от друга, чтобы быть точно идентифицированными, даже если число их символов, вплоть до определенного предела, изменяется. За этим пределом может быть ошибочно идентифицировано другое сообщение. Код, исправляющий ошибки, интерпретируется как набор сообщений, подверженных ограничениям, которые делают их символы взаимозависимыми. Хотя математические ограничения удобно использовать в технике, ограничения любого другого рода, возможно естественного происхождения, могут генерировать коды, исправляющие ошибки. Биологи неявно предполагают, что геномы были сохранены в течение геологических эпох, не понимая, что это невозможно без средств исправления ошибок. Ошибки символов возникают во время репликации генома; химические реакции и излучения являются другими источниками ошибок. Их количество увеличивается со временем при отсутствии коррекции. Геномный код точно восстановит геном при условии, что его декодирование будет предпринято через достаточно короткий промежуток времени. Однако если число ошибок слишком велико, то расшифрованный геном будет отличаться от исходного и произойдет мутация. Таким образом, периодические попытки декодирования сохранят геном, за исключением очень редких мутаций, если попытки декодирования достаточно часты. Лучшая сохранность очень древних частей генома, таких как HOX-гены, не может быть объяснена, если не предположить, что существует геномный код, исправляющий ошибки в результате пошагового кодирования: за первым кодированием последовало второе, где новая информация и результат первого кодирования были совместно закодированы, и этот процесс повторялся несколько раз, в конечном итоге приводя к общему коду, состоящему из вложенных компонентов, где чем старше информация, тем лучше она защищена. Органические коды в понимании Барбьери являются результатом одного и того же процесса и имеют одну и ту же структуру. Любой новый органический код вызывает новые геномные ограничения, следовательно, новые компоненты во вложенной системе кодов. Таким образом, органические коды могут быть идентифицированы с системой вложенных кодов исправления ошибок, необходимых для сохранения генетической информации. Большинство биологов отрицают, что теория информации может быть им полезна. Напротив, показано, что живой мир не может быть понят, если не принимать во внимание научное понятие информации. Наследственность заставляет настоящее общаться с прошлым, и как процесс коммуникации имеет отношение к теории информации, которая, таким образом, является необходимой основой биологии помимо физики и химии. Вложенные геномные коды исправления ошибок, необходимые для сохранения генетической информации, составляют иерархическую таксономию, которая структурирует живой мир. Более того, основные черты биологической эволюции, в том числе ее тенденция к усложнению, находят свое объяснение именно в этих рамках. Включение научной концепции информации и науки, основанной на ней, в основы биологии может широко обновить эту дисциплину, но сталкивается с эпистемологическими трудностями, которые необходимо преодолеть.

Ключевые слова: Коды с исправлением ошибок; безошибочная связь; наследственность; теория информации; органические коды.

Copyright © 2019. Опубликовано Elsevier B. V.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 22.09.2020, 05:21:23
О как! Уже и случайная жизнь невозможна! :(
А, почему, позвольте узнать?
Потому, что нет научных данных (фактов, наблюдений, опытов) о самозарождение жизни хоть в грязном белье, хоть в грязной воде.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 22.09.2020, 05:42:33
Вы не имеете привычки вчитываться в разговор, куда влезаете? Не?
речь шла чем случайная последовательность дырок на перфоленте может походить на случайную последовательность триплет-кодонов в ДНК.

неслучайным синтезом вставляющим нуклеотид в последовательность ДНК. Об этом речь, Кто то следуя творческому замыслу туда его поставил в своё время, у природы за доставку нуклеотида в нужное место пространства отвечают законы физики, если раствор цитоплазмы в первичной протоклетке в равных пропорциях равномерно содержит хирально грязную смесь активных нуклеотидов, 8 штук, то вероятность что присоединится нужный нуклеотид равна 1/8=0,125. Таковы законы физики. Законы химии это как бы биологический язык с набором правил, таких как принцип комплементарности, гидрофильность и гидрофобность молекул, ковалентные ионные и водородные связи, строго определенная пространственная структура молекул, правила разрешающие и запрещающие направление протекания химических реакций и многое другое, что позволяет синтезировать из простых молекул макромолекулы и живые организмы. физико-химические процессы имеют две составляющие, хаос и правило. Вы принципиально не хотите учитывать физическую компоненту хаоса, вероятностный множитель. Дырки на перфоленте нанесены неслучайно, чтобы автоматически по телеграфу передать последовательность символов, которые вы распознаете как свежий выпуск газеты Правда, а так как вам нужно передать во все региональные типографии новый выпуск используете перфоленту. Такая же перфолента ДНК, только когда она печаталась никаких издательств Правды не было, как и главреда. Но Кто то её напечатал на перфоленте ДНК в полном соответствии с правилами языка химии. Физика делает при кадром нажатии клавиши в среднем ошибку с вероятность 1-0,125 = 0,875. Представьте что оператор телеграфист перепечатывая безошибочный текст главреда Правды делал ошибку передовая информацию 5-битным кодом при нажатии клавиши вероятность что угадал символ 1/32=0,03125, а вероятность ошибки 1-0,03125=0,96875, что получит читатель на выходе газеты? 
(https://ds04.infourok.ru/uploads/ex/1319/0010ef80-f6bc0cfa/img9.jpg) Тот кто печатал перфоленту ДНК был грамотным оператором-машинисткой, у машиниста немного другой смысл.         



Цитировать
Абсолютно незачем. Существуют бесчисленные археологические, антропологические и тд находки из той местности и того времени. У нас нет никаких проблем сопоставить факт наличия останков людей и следов материальной культуры, в частности этой таблички.
так никто не отрицает что это сделали не обезьяны, тут признак разума, а разумом обезьяны не обладают. Просто на данный момент тот кто написал эти тексты не существует, а существовал и писал их в пролом, вы не можете конкретного автора представит мне, а от меня требуете представить Бога, который творил жизнь в прошлом. вы предлагаете условного человека в авторы, я предлагаю условного Бога в авторы. 

Цитировать
Вы все никак не можете понять, что "самовоспроизводящийся автомат с генетической программой и кодом" есть продукт долгой эволюции.
Вы же игнорируете в этой эволюции вероятностный коэффициент это подход научпопа для школоты и научных атеистов для неучей лохов. Срок такой эволюции намного много порядков превосходит возраст нашей вселенной.

Цитировать
Совершенно незачем было случайно организовываться всему сразу, хотя никакими законами это не запрещено.
но ограничено законами термодинамическим физики, отсюда высокая вероятность ошибки при печати.
Цитировать
в разных областях понятие "pattern" имеет различные значения, но в науке оно означает повторяющиеся и предсказуемые естественные конфигурации.
Цитировать
Что еще за "синтез ДНК"? Репликация?
нет, в смысле построения полинуклеотидной последовательности присоединением новых нуклеотидов, синтез в смысли сборки, из контекста это было видно.   
Цитировать
Откуда у вас человек и протоклетка?
Путь к человеку начался с абиогенеза внутри простой протоклетки липидного пузыря. Гипотетическая простейшая протоклетка созданная в лаборатории.
Искусственные протоклетки синтезируют ДНК без помощи ферментов (https://elementy.ru/novosti_nauki/430749/Iskusstvennye_protokletki_sinteziruyut_DNK_bez_pomoshchi_fermentov)
Цитировать
А что такое минимальный набор ДНК? :)
минимально необходимый(простой работающий) молекулярный механизм ферменты рибосома и все виды РНК должны возникнуть,  существовать локализовано внутри ограниченного пространства протоклетки независимо от ДНК, при этом на ДНК должны все эти независимые молекулярные механизмы быть закодированы в последовательности ДНК.   

Цитировать
Теорий появление генетического кода более чем, ничего невероятного в этом нет. Одну из них я даже вам давал почитать:
Происхождение белкового синтеза и генетического кода (https://istina.msu.ru/media/publications/article/13d/fbb/7360574/2013_07_20-23.pdf)

Я против этой статьи ничего не имею, кроме того что в угоду научного атеизма или борьбы с разумным замыслом они игнорируют легко вероятностный коэффициент. Это делается для неучей и школьников.   
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 22.09.2020, 05:43:08

Вы под "защищает" что понимаете? Естественный отбор удаляет из популяции вредные мутации.
Полезные мутации защищать не нужно, они и так дают преимущество своим обладателям. Не в любую секунду. Вредная мутация может возникнуть при передаче генетической информации, то есть у потомков. Так ЕО уберет ее из популяции тем верней чем вреднее она будет. Только и всего.
Так на белках все и построено. Белки, разумеется,  тоже эволюционируют.
Защищает от изменений. Половые клетки в организме образуются постоянно, и с какой стати им каждый раз постоянно сохранять полезные мутации того же глаза? Если глаз возникает постоянным случайным перебором всех вариантов, то что закрепляет полезные мутации от дальнейшего перебора? И каким образом преимущество влияет на случайном переборе? Случайный перебор ни от чего не зависит, ибо случайный и хаотичный.

Потомок получил полезный ген от родителей, возникшей 1 раз на миллион случайных повторений, и он так же у потомка изменится и перестанет быть полезным, ибо любое последующее изменение по теории вероятности уничтожит полезную комбинацию, как изменение 1 карты уничтожает джек-пот, а изменение 1 цифры в лотерее от выигрышной комбинации. Имеем в итоге деградацию, а не эволюцию.

Белки на могут сами эволюционаровать, ведь ими урпавляют случайный набор генов. 
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 22.09.2020, 05:49:59
Потому, что никто еще не доказал, что там есть семантика.
Какое? :)
Я вам привёл науч.работы, где говорится о семантике кода ДНК. Вы возразили, что там есть слово "как", но по правилам русского языка слово "как" не означает отрицание. Иначе выражение "машина как средство передвижения" означало бы, что машина не является средством передвижения.

Следовательно вы должны привести другие аргументы, что эти науч.работы не говорят о семантике кода ДНК.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 22.09.2020, 05:58:37
Цитировать
Цитата: Модест Матвеевич от Вчера в 10:16:12
О как! Уже и случайная жизнь невозможна! :(
А, почему, позвольте узнать?
Потому, что нет научных данных (фактов, наблюдений, опытов) о самозарождение жизни хоть в грязном белье, хоть в грязной воде.
Как будто не понимает что если вероятность стремится к нулю, то совершение события стремится к невозможности. Нет таких химических правил и законов, которые на нужное место в нужное время поставили нужный нуклеотид, и это последовательная постановка в полинуклеотидную цепь этими законами химии была определена вся структура жизни, химия не пишет программу жизни, она определяется правила присоединения, а пишет физика, она ответственна за траектории движение молекул, за доставку к месту химических реакций, а тут вступает вероятностный коэффициент отвечающий за вероятность события, доставка материальной точки к месту взаимодействия с другой материальной точкой всегда случайное событие в физике.       
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 22.09.2020, 07:45:40
Защищает от изменений. Половые клетки в организме образуются постоянно, и с какой стати им каждый раз постоянно сохранять полезные мутации того же глаза? Если глаз возникает постоянным случайным перебором всех вариантов, то что закрепляет полезные мутации от дальнейшего перебора? И каким образом преимущество влияет на случайном переборе? Случайный перебор ни от чего не зависит, ибо случайный и хаотичный.
Поэтому в селекции растений естественные мутации используются только при вегетативном размножении (например, почковые мутации у плодовых культур). С половым размножением так просто не выходит - Мичурин поэтому устал "ждать милостей от природы" и начал подбирать исходники, - хотя теоретически возможно, что семя образуется из нужной пыльчинки, но вероятность почти нулевая. К тому же мутация, полезная в культуре, в дикой природе не факт, что будет полезной. А такая, как безсемянность, вообще будет вредной.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 22.09.2020, 14:57:38
Основная причина этого заключается в том, что современная биология предполагает, что знаки и значения не существуют на молекулярном уровне, и что генетический код не сопровождался никаким другим органическим кодом в течение почти четырех миллиардов лет, что означает, что он был полностью изолированным. исключение в истории жизни. Эти идеи фактически исключили существование семиозиса в органическом мире, но все же существуют экспериментальные факты против всех них. Если мы посмотрим на свидетельства жизни без предварительных условий настоящей парадигмы, мы обнаружим, что семиозис присутствует в каждой отдельной клетке, и что он был там с самого начала. В этом суть биосемиотики. Это не философия. Это новая научная парадигма, строго основанная на экспериментальных фактах. Биосемиотика утверждает, что генетический код (1) является настоящим кодом и (2) был первым из длинной серии органических кодов, которые сформировали историю жизни на нашей планете. Реальность генетического кода и существование других органических кодов подразумевает, что жизнь основана на двух фундаментальных процессах - копировании и кодировании - а это, в свою очередь, означает, что эволюция происходила с помощью двух различных механизмов, то есть путем естественного отбора (на основе о копировании) и по естественным соглашениям (на основе кодирования) ». «Эти сущности так же реальны, как и физические величины, в том смысле, что они одинаково необходимы для описания биологических систем, а это означает, что мы никоим образом не можем отбрасывать их как лингвистические метафоры». «... мы увидели, что биосемиотика была разработана независимо, по крайней мере, в пяти различных направлениях исследований. Один из них - это подход Себека-Хоффмейера, который основан на определении знака Пирсом и предполагает, что интерпретация является фундаментальной особенностью семиозиса. Второй - это направление исследований органических кодов, в котором семиозис основан на кодировании, а не на интерпретации, а остальные три - это подходы, разработанные соответственно Грегори Бейтсоном, Говардом Патти и Антоном Маркошем. Это заставляет нас понять, что биосемиотика - все еще развивающаяся наука, в которой еще предстоит решить многие, даже важные, вопросы. Во всяком случае, все версии биосемиотики разделяют идею о том, что семиозис является фундаментальным для жизни, т. Е. Что все живые существа являются семиотическими системами, и важно то, что у нас уже есть достаточно экспериментальных данных в пользу этой идеи. В заключение, биосемиотика - это действительно новая парадигма как для биологии, так и для семиотики, но ее будущее непредсказуемо. Это действительно похоже на новый континент, освоение которого только начинается ».
Александр, вы почему-то исключаете Бога из картинки. Что мне непонятно, поскольку вы как раз верующий.

Разумеется, вокруг происходит много вещей, маловероятных на первый взгляд. Научно это объяснить невозможно, только сослаться на случайность. Почему ветер отогнал воду в море не раньше и не позже, а в точности в тот момент, когда Моше поднял руку? Почему вода вернулась в точности тогда, когда евреи уже перешли, а египтяне нет? Физической причины для этого нет, как нет и нарушения физических законов. А произошло это потому, что евреев вел Бог.

То же самое с генетическим кодом. Да, представляется весьма маловероятным, чтобы молекулы сами по себе образовали подобные цепочки. Для этого нужно невероятное стечение различных условий, каких именно - наука пока толком не знает. (Эти условия обсуждаются, например, в вики (https://ru.wikipedia.org/wiki/%D0%93%D0%B8%D0%BF%D0%BE%D1%82%D0%B5%D0%B7%D0%B0_%D0%BC%D0%B8%D1%80%D0%B0_%D0%A0%D0%9D%D0%9A#%D0%A2%D1%80%D1%83%D0%B4%D0%BD%D0%BE%D1%81%D1%82%D0%B8).) Но верните Бога в картинку, и все станет на свои места! Да, Бог сделал так, чтобы физические и химические обстоятельства на планете сложились именно таким образом, чтобы стало возможным усложнение молекул вплоть до белков и простейших РНК.

Собственно, ровно то же самое можно сказать и про саму планету Земля, хотя никаких особенных "кодов" здесь нет - просто обыкновенная планета. Обыкновенная, но все же обстоятельства ее появления - орбита, свойства Солнца, магнитосфера, Луна, водная оболочка - подобраны таким образом, что Земля оказалась единственной из многих тысяч уже открытых экзопланет, прекрасно подходящей для развития жизни.

Даже то, что мы сейчас с вами общаемся - разумеется, случайность с научной точки зрения. Но это "случайность" в рамках единого замысла Творца, Которому было угодно, чтобы мы сейчас пообщались.

Если хотите, я могу представить свой вариант понимания, что значит "естественное" и "искусственное", с точки зрения всего проекта нашего мироздания - 10 Дней Творения.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 22.09.2020, 15:01:43
Очевидно, начать надо с того, что вы согласились с моим основным тезисом: никакого критерия искусственности придумать невозможно. Можно лишь назвать искусственным то, что произведено человеком, и затем проверять гипотезу, действительно ли человек в этом участвовал.
О чем же мы тогда спорим? В этом случае тема вырождается в тривиальщину, и вроде бы спорить решительно не о чем. Разумеется, человек не проектировал ДНК. Но и любые действительно интересные споры ученых о том, имеют ли те или иные космические сигналы искусственное происхождение, на таком языке невозможно сформулировать. Разумеется, любые сигналы из дальнего космоса не имеют отношения к человеку и в этой терминологии естественны. Даже если на Красной площали приземлится инопланетный космический корабль - он естественен, так как человеком не произведен.
По поводу нюансов можно поговорить.
Насколько я понимаю, критерий искуственности существует, поскольку существует прямая противоположность искуственности, а именно естественность.
Опять же, на сколько я понимаю, третьего не дано.
Либо искуственность, либо естественность.

Таким образом не естественное и является искуственным.
Вот вам и критерий, без какого бы то ни было знания истории объекта и знания конкретного создателя объекта.

Цитировать
Не вижу, чтобы технологии двигались только по пути громоздкости. Да, это наиболее легкий путь чего-то добиться - нагромоздить достаточную кучу деталей. Но бывают и гениальные изобретения. Бывает и постепенное совершенствование, когда предмет постепенно избавляется от излишней громоздкости.
Тут не столько сама "громоздкость" технологий, сколько просто увеличение материальных следов. По мере развития цивилизации растут задачи решаемые человеком, задачи эти требуют все более и более "громоздкоемких" решений.
Цитировать
Сравните БЭСМ-6 и сотовый телефон.
Конечно, телефон меньше, но сколько их было, тех БЭСМ? А телефон сегодня в кармане у каждого. Суммарная их масса на много превосходит суммарную массу первых вычислительных машин. 
Цитировать
Стругацкие, в отличие от Лема, не ставили задачи построить действительно правдоподобную модель иной цивилизации. Их роман о другом. Но, честно говоря, особой громоздкости в этих артефактах я не заметил - они структурно проще, чем большинство наших инструментов. А такие вещи, как "мясорубка", "ведьмин студень", "жгучий пух", "комариная плешь" и так далее вообще сложно отнести к естественному или искусственному, если исходить из человеческих параллелей.
Вы сами привели пример, а теперь выясняется , он не подходит.
Интересно, как вы оцениваете правдоподобие иных цивилизаций?
Цитировать
Собственно, даже про шар желаний трудно сказать что-то определенное. Ну шар. Ну золотистый. Ну, желания исполняет. И с какой стати надо считать, что это искусственный предмет? Естественные шары тоже бывают. Может, это животное такое, умное и круглое, которое они привезли со своей планеты и которое умеет исполнять чужие желания с помощью телепатии, телепортации и прочих научно-фантастических фокусов.
В природе обнаружены круглые шары, исполняющие желания? Есть гипотезы, как такие шары могут возникать в естественных условиях?
Цитировать
Э... вы окончательно запутались :)
Нет, моя мысль пряма, как клинок и так же остра.
Цитировать
Когда вещь трудно обосновать, проще всего ее назвать "самоочевидной" :)
Я не согласен и аргументировал свою позицию. Пушка мощнее лука и стрел. Но гораздо менее эффективна.
Да? А ничего, что стрела никак не может выполнять функции артиллерийского снаряда?
Постреляйте из лука в железобетонное укреплений, потом в него же их орудия, сравните эффект.  :)
Цитировать
Скорее, для того, чтобы случайно не бабахнуло.
Для того, что бы появилась возможность случайного бабаха, нужно приложить гигантское количество высокотехнологичных усилий.

Цитировать
Праща - это не просто праща. Это праща + человеческая рука и человеческий мозг, позволяющие ей эффективно воспользоваться.
Вирус, в отличие от пращи, работает автономно от человека. Поэтому, да, создать его гораздо сложнее. Но... возможно. И это тоже пример совершенства, только "на другом конце шкалы".
Простите, вы как будто идете по поверхности диалога, не замечая главного. Вы же согласны, что боевой вирус искусственен. Но при этом он неотличим от естественного!
Вам, с вашей терминологией, придется присвоить тому же коронавирусу статус "естественный" или "искусственный" не на основании свойств этого вируса, а только по результатам детективных расследований. Если докажут, что его разработали в такой-то лаборатории, то он окажется "искусственным", если докажут обратное, то "естественным", а может быть, вопрос так и повиснет в воздухе.
То же самое, если вирус выведен с помощью генной инженерии, то его искусственность гораздо легче обнаружить, чем если он выведен искусственным отбором (вирусоводством). Снова мы видим, чем технологичнее способ, тем легче идентифицировать искусственный объект.
Цитировать
И зачем тогда вообще нужен такой термин? Тогда надо говорить не "искусственный", а "искусственного происхождения (в скобках - произведено человеком)".
Это не одно и тоже?
Цитировать
Что-то вы снова все пропустили... Ну, поставьте эксперимент. Бросьте где-нибудь в лесу, подальше от города, какие-нибудь предметы искусственного происхождения. Книжку там, телефон, кочергу. А потом попробуйте их там отыскать лет через десять. Зачем ждать тысячу...
Никогда не были на свалке? Свалка - помойка это самая желанная находка археолога.
Цитировать
Даже такие значительные артефакты, как асфальтовые дороги, разрушаются дождями и солнцем довольно быстро. Бывает, конечно, долговечный мусор, но это относительная "долговечность" - могут потребоваться упомянутые тысячи лет. А за миллионы лет почти наверняка произойдет какое-нибудь землетрясение, наступление ледников или извержение вулкана, так что даже гигантские каменные постройки вроде пирамид с вероятностью 99.999...% исчезнут бесследно.
Еще раз. Опознают следы присутствия бактерий через 3,5 миллиарда лет, а вы про асфальт-пирамиды. Смешно!
Цитировать
При этом очевидно же, что если ДНК и правда проектировала какая-то сверхцивилизация, то, в отличие от самолюбимых фараонов, она не ставила цели оставить внешние следы, а наоборот, скорее всего, работала аккуратно. Прилетели, что-то сделали, прибрались за собой и улетели. Примерно так работает любая научная экспедиция, скажем, геофизики в том же лесу (я однажды был в такой экспедиции). Поверьте, при всей важности и масштабности этой работы, никаких особенных следов, которые потом можно обнаружить, экспедиция не оставляет - разве что колеи от колес и случайно забытый кем-то мусор. Но через очень небольшое время - годы, десятилетия, максимум столетия - на том болоте, где мы работали, никаких следов не останется.
А если бы, в свою очередь, они действительно хотели оставить следы, то оставили бы их на Луне - какую-нибудь многокилометровую пирамиду из золота или что-нибудь подобное.
Это опять фантазирование. Пока нет фактов, говорить тут не о чем.
Цитировать
Правильно, не надо.
Для науки такой подход неприемлем.
Цитировать
Если все создал Бог, если в этом не участвовала никакая цивилизация, то, разумеется, ДНК естественны.
Тезис Александра в том, что абиогенез событие невероятное и в естественных условиях, без разумного вмешательства, практически невозможное. Такое естественным не назовешь.
Цитировать
Это, вообще говоря, объяснение неизвестного через непонятное. Веревка есть вервие простое.
Что значит "над"? А если "под" (ад), то не пойдет? Законы природы - а что называется природой? Внутренние органы ангелов - это природа или нет? Или это не природа до тех пор, пока ни один ученый ангела не ощупал, а после этого станет называться природой? Что значит "выпадает из причинной цепи"? Наверно, черти и ангелы тут ни при чем, ведь их действия логичны и имеют свои причины - похоже, автор имел в виду самопроизвольный распад нейтрона... И, наконец, что значит "первичное по отношению к реальности"? Эти "сверхъестественные" существа либо реальны, либо нет. В первом случае они не первичны, во втором - их вообще нет, соответственно, воздействовать на реальность просто некому. Наконец, при сопоставлении ангелов, языческих божеств и подобных созданий с человеком первичным, по Библии, окажется человек, а не они. Важнее человека на Земле только Бог, а Он как раз отличается тем, что, как ни странно, вообще никаких законов природы не нарушает и за их рамки не выходит. Вместо этого, Он эти законы разрабатывает.
В общем, это больше претензия на объяснение, набор популярных ключевых слов, чем настоящий анализ понятия.
Если хотите забалтывать, то без меня.
Цитировать
Потому, что хочу обсуждать нетривиальные вопросы, а не тавтологии. Разумеется, если, как вы предложили, называть искусственным то, что произведено человеком, то для выяснения искусственности нужно историческое расследование, а не изучение самого предмета. Или не нужно, если данное явление старше самого человечества.
Но тема для обсуждения при этом автоматически исчезает.
А одно другому никак не мешает. Историческое расследование и исторические аналогии могут сильно помочь и ускорить процесс. Не находите?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 22.09.2020, 15:07:28
Потому, что нет научных данных (фактов, наблюдений, опытов) о самозарождение жизни хоть в грязном белье, хоть в грязной воде.
Очередной пример логики.
Надо понимать, если фактов наличия Творца у нас нет, то существование его, даже случайное невозможно?
Так? ;)
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 22.09.2020, 15:15:11
Насколько я понимаю, критерий искуственности существует, поскольку существует прямая противоположность искуственности, а именно естественность.
Опять же, на сколько я понимаю, третьего не дано.
Либо искуственность, либо естественность.
Таким образом не естественное и является искуственным.
Вот вам и критерий, без какого бы то ни было знания истории объекта и знания конкретного создателя объекта.
Что такое естественность? Я уже задавал этот вопрос, вы куда-то ушли.

Единственное определение, которое приходит мне на ум, тавтологично: естественным называется процесс, развивающийся в соответствии с естественными законами природы. Но это касается абсолютно всех процессов в материальном мире, даже нашего с вами общения. Как верующий, я знаю это из Торы, а как современный человек, вижу, что наука до сего дня это полностью подтверждает.

Тут не столько сама "громоздкость" технологий, сколько просто увеличение материальных следов. По мере развития цивилизации растут задачи решаемые человеком, задачи эти требуют все более и более "громоздкоемких" решений.
Повторение тезиса + игнорирование возражений не делают тезис более убедительным.

Интересно, как вы оцениваете правдоподобие иных цивилизаций?
Я не оцениваю, я знаю, что они существуют, и знаю их место и функции по отношению к нашей планете. 4-й урок курса.

В природе обнаружены круглые шары, исполняющие желания? Есть гипотезы, как такие шары могут возникать в естественных условиях?
А в мире искусственных изделий, созданных человеком, существуют такие шары? Есть гипотезы, как такой шар сконструировать?
Поскольку у этого предмета (или существа) нет аналогий на Земле, то наши ссылки на сходство с человеческими механизмами или с земными животными "не работают".

Нет, моя мысль пряма, как клинок и так же остра.
И постепенно становится столь же неинтересной, извините. Я надеялся вывести диалог на конструктивный анализ понятия "искусственность", но, как это обычно и бывает на форумах, все свелось к малосодержательному обмену репликами. Такое впечатление, что вы хотите не разобраться в вопросе, а отстоять свою правоту: ни один мой аргумент, кажется, не был не только оспорен, но даже минимально подробно проанализирован.

Что ж, как хотите. С уважением.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 22.09.2020, 15:16:52
Почему это заблуждение, если это вытекает из логики? В чём логическая ошибка?

Чем понятие кода этих программистов отличается от вашего, например?
По здравом размышлении соглашусь. Переход от кода к микропрограммам в компьютере и переход от кодонов к аминокислотам логически не отличаются.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 22.09.2020, 15:28:13
неслучайным синтезом вставляющим нуклеотид в последовательность ДНК.
Еще раз. Чтобы не попасть в глупое положение, как сейчас, читайте о чем идет речь перед тем, как что-либо написать.

Цитировать
так никто не отрицает что это сделали не обезьяны, тут признак разума, а разумом обезьяны не обладают. Просто на данный момент тот кто написал эти тексты не существует, а существовал и писал их в пролом, вы не можете конкретного автора представит мне, а от меня требуете представить Бога, который творил жизнь в прошлом. вы предлагаете условного человека в авторы, я предлагаю условного Бога в авторы. 
Я вас прошу предъявить следы, хоть какого агента способного запрограммировать ДНК. И, согласитесь, я совсем не виноват, что они отсутствуют.
Цитировать
Вы же игнорируете в этой эволюции вероятностный коэффициент это подход научпопа для школоты и научных атеистов для неучей лохов. Срок такой эволюции намного много порядков превосходит возраст нашей вселенной.
Давайте начнем с того, что это вы игнорируете современные научные представления, по нашему вопросу. Вы либо не понимаете, либо сознательно перевираете содержание статей и заметок.

Теперь, что это за "вероятностный коэффициент"? Это ваше собственное ни на чем не основанное изобретение или дадите ссылку?
Цитировать
Путь к человеку начался с абиогенеза внутри простой протоклетки липидного пузыря. Гипотетическая простейшая протоклетка созданная в лаборатории.
Ну и где в статье про человека? На каком выходе, вы хотите его получить?
Что за дичь, вы порете? :o
Цитировать
минимально необходимый(простой работающий) молекулярный механизм ферменты рибосома и все виды РНК должны возникнуть,  существовать локализовано внутри ограниченного пространства протоклетки независимо от ДНК, при этом на ДНК должны все эти независимые молекулярные механизмы быть закодированы в последовательности ДНК.   
А ученые с вами не согласны.

Итак, большинство вспомогательных молекул белкового синтеза изначально имели другие функции и могли возникнуть раньше, чем рибосомы.

Изучение структуры рибосомной РНК (рРНК) показало, что она могла быть построена постепенно, путем добавления новых доменов. Это следует из распределения одного из типов связей — водородных связей между несколькими последовательными аденинами в одноцепочечном участке и гидроксилами рибозы в двухцепочечном участке. Такая связь нужна для устойчивости одноцепочечного участка, но не важна для двухцепочечного, поэтому она могла возникнуть только если одноцепочечный участок аденинов добавился после двухспирального фрагмента.
(https://forany.xyz/ax/d1/1/a282/9c6fcab8cde144a3f5eb107f0156e307.jpg)
На рис. 4 мы видим распределение таких контактов в большой рибосомной РНК кишечной палочки. Темными кружками обозначены двуспиральные участки, светлыми — адениновые односпиральные, присоединенные к ним. Видно, что многие контакты направлены к пятому домену и почти никогда — от него. Это означает, что пятый домен был древнейшим, а остальные части рибосомной РНК надстроились позже (Константин Боков и Сергей Штернберг из университета Монреаля, «Nature», 2009, 457, 977—980, doi: 10.1038/nature07749).

Как могла работать такая древняя рибосома, без белков и без части доменов рРНК? На пятом домене находится пептидилтранферазный центр рибосомы — он присоединяет новые аминокислоты к растущему пептиду. Однако этот домен не принимает участия в связывании матричной РНК и никак не может контролировать последовательность пептида. Получается, что древняя рибосома, скорее всего, синтезировала пептиды случайного состава, без участия мРНК. Мог ли такой примитивный белковый синтез как-то пригодиться в РНК-мире?

В поисках ответа исследователи обратили внимание на то, что многие белки, образующие альфа-спираль, могут неспецифически связываться с двуспиральной РНК. При этом карбонильные группы пептидной цепи образуют водородные связи с 2'-гидроксильными группами остатков рибозы, тем самым защищая РНК от многих неприятностей. С атаки на эти ОН-группы начинается гидролиз РНК щелочами, ионами металлов и ферментами РНКазами. Боковые группы аминокислот в этих контактах не участвуют, иными словами, последовательность аминокислот не так важна — пептид случайной последовательности или из повторяющихся остатков одной аминокислоты уже обеспечивает заметную защиту.

В мире РНК с появлением эффективно самокопирующихся рибозимов нуклеотиды стали дефицитным ресурсом, и некоторые рибозимы стали получать их, гидролизуя соседей. В таких условиях защитный пептид мог обеспечить большое преимущество и, что более важно, спровоцировать «гонку вооружений». «Хищные» рибозимы стали учиться расщеплять белки, «жертвы» отвечали на это изменением и усложнением состава аминокислот в защитных пептидах. На этом пути добавление любой новой аминокислоты в арсенал пептидного синтеза подхватывалось отбором. Адаптивным, видимо, был и переход от простого регулярного чередования нескольких аминокислот к сложным последовательностям пептидов, для чего пригодился матричный синтез — так появились мРНК, тРНК и генетический код.
Происхождение белкового синтеза и генетического кода (https://istina.msu.ru/media/publications/article/13d/fbb/7360574/2013_07_20-23.pdf)
Цитировать
Я против этой статьи ничего не имею, кроме того что в угоду научного атеизма или борьбы с разумным замыслом они игнорируют легко вероятностный коэффициент. Это делается для неучей и школьников.   
Вам осталось только рассказать всем про ваше новое изобретение - "вероятностный коэффициент". :D
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 22.09.2020, 15:51:15
Защищает от изменений. Половые клетки в организме образуются постоянно, и с какой стати им каждый раз постоянно сохранять полезные мутации того же глаза? Если глаз возникает постоянным случайным перебором всех вариантов, то что закрепляет полезные мутации от дальнейшего перебора?
Вам же писали  - отбор. Мутации могут ломать что угодно, отбор это из популяции убирает, остаются только особи с глазами. Причем особи у которых глаза лучше оставляют больше потомства, тем самым гены "хороших глаз" распространяются в популяции.

Цитировать
И каким образом преимущество влияет на случайном переборе? Случайный перебор ни от чего не зависит, ибо случайный и хаотичный.
Мутации случайны. Преимущество проявляется при жизни организма.
Цитировать
Потомок получил полезный ген от родителей, возникшей 1 раз на миллион случайных повторений, и он так же у потомка изменится и перестанет быть полезным, ибо любое последующее изменение по теории вероятности уничтожит полезную комбинацию, как изменение 1 карты уничтожает джек-пот, а изменение 1 цифры в лотерее от выигрышной комбинации. Имеем в итоге деградацию, а не эволюцию.
Геном, знаете ли, большой, мутации в нем случайны. Очень маловероятно, что бы в одном гене они происходили непрерывно из поколения в поколение.
Цитировать
Белки на могут сами эволюционаровать, ведь ими урпавляют случайный набор генов.
Естественно. Эволюция белков, как и эволюция органов это следствие эволюции генома. Собственно без эволюции белков никакие новые органы невозможны.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 22.09.2020, 16:08:21
Я вам привёл науч.работы, где говорится о семантике кода ДНК. Вы возразили, что там есть слово "как", но по правилам русского языка слово "как" не означает отрицание. Иначе выражение "машина как средство передвижения" означало бы, что машина не является средством передвижения.
Следовательно вы должны привести другие аргументы, что эти науч.работы не говорят о семантике кода ДНК.
Вам необходим ликбез по русскому языку. "Как" это сравнение.
Фраза: "Ты, как слон", совсем не означает, что речь идет действительно слоне.

А, "машина как средство передвижения" это тавтология.

Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 22.09.2020, 16:08:45
Вам же писали  - отбор. Мутации могут ломать что угодно, отбор это из популяции убирает, остаются только особи с глазами. Причем особи у которых глаза лучше оставляют больше потомства, тем самым гены "хороших глаз" распространяются в популяции.
Осталось понять, как возникли эти глаза.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 22.09.2020, 18:04:06
Что такое естественность?
Все, что возникло без участия человека?

Цитировать
Повторение тезиса + игнорирование возражений не делают тезис более убедительным.
Я повторяю не тезис, а наблюдаемый факт. С развитием технологий растет количество восокотехнологичных следов цивилизации, который все труднее трактовать, как естественные.
А возражений никаких не было. Нельзя же считать возражением сравнение глазного протеза с броненосцем? :)
Что же до фантазий, как оно там все будет дальше, то фантазировать можно, как в одну, так и в другую сторону.
Цитировать
Я не оцениваю, я знаю, что они существуют, и знаю их место и функции по отношению к нашей планете. 4-й урок курса.
Остается только поздравить столь осведомленного человека. :)
Цитировать
А в мире искусственных изделий, созданных человеком, существуют такие шары? Есть гипотезы, как такой шар сконструировать?
Поскольку у этого предмета (или существа) нет аналогий на Земле, то наши ссылки на сходство с человеческими механизмами или с земными животными "не работают".
Я такими ссылками и не пользовался, если вы не заметили. Поскольку соответствующих природных процессов мы не знаем, то с большой долей вероятности он искусственный.
Факт, что Шар появился после прибытия инопланенян также идет в копилку доводов его искусственности.
Цитировать
И постепенно становится столь же неинтересной, извините. Я надеялся вывести диалог на конструктивный анализ понятия "искусственность", но, как это обычно и бывает на форумах, все свелось к малосодержательному обмену репликами. Такое впечатление, что вы хотите не разобраться в вопросе, а отстоять свою правоту: ни один мой аргумент, кажется, не был не только оспорен, но даже минимально подробно проанализирован.
Что ж, как хотите. С уважением.
Ничего страшного. Вы правы в том, что бездоказательная болтовня и фантазирование, действительно, не мое амплуа.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 22.09.2020, 18:06:56
Осталось понять, как возникли эти глаза.
Постепенно. Путем эволюции.
(https://upload.wikimedia.org/wikipedia/commons/thumb/b/b6/Diagram_of_eye_evolution.svg/525px-Diagram_of_eye_evolution.svg.png)
https://ru.qwe.wiki/wiki/Evolution_of_the_eye
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 22.09.2020, 23:06:32

Происхождение белкового синтеза и генетического кода (https://istina.msu.ru/media/publications/article/13d/fbb/7360574/2013_07_20-23.pdf)Вам осталось только рассказать всем про ваше новое изобретение - "вероятностный коэффициент". :D

Вначале была РНК? В поисках молекулы первожизни

Кандидат биологических наук С. Григорович
«Наука и жизнь» №2, 2004
(https://scisne.net/a-2398)
.......
МИР РНК

Мы остановились на деталях строения РНК неслучайно. В конце ХХ века произошел очередной переворот в теории возникновения жизни, "виновницей" которого как раз и стала эта молекула, до того времени казавшаяся тщательно изученной и достаточно предсказуемой.

Началась эта история в 70-х годах ХХ века, когда в клетках некоторых организмов были обнаружены необычные ферменты: они включали в свой состав кроме белка еще и молекулу РНК. В конце 70-х годов американские биохимики Томас Чек и Сидни Альтман независимо друг от друга изучали структуру и функции таких ферментов. Одной из задач было выяснение роли РНК, входящей в их состав. Вначале, следуя общепринятому мнению, ученые полагали, что молекула РНК является в таких комплексах лишь вспомогательным элементом, отвечающим, может быть, за построение правильной структуры фермента или за правильную ориентацию при взаимодействии фермента и субстрата (то есть той молекулы, которая и подвергается изменению), а саму катализируемую реакцию выполняет белок.

Для того чтобы прояснить ситуацию, исследователи отделили белковую и РНК составляющие друг от друга и исследовали их способности к катализу. К своему огромному удивлению, они заметили, что даже после удаления из фермента белка оставшаяся РНК была способна катализировать свою специфическую реакцию. Такое открытие означало бы переворот в молекулярной биологии: ведь раньше считалось, что к катализу способны лишь белки, но никак не нуклеиновые кислоты.

Но, может быть, все дело в неэффективной очистке РНК, при которой на ней все же остается какой-то неуловимый, минимальный кусочек белка, способный осуществлять катализ?

Последним, самым убедительным доказательством способности РНК к катализу стала демонстрация того, что даже искусственно синтезированная РНК, входящая в состав изучаемых ферментов, может самостоятельно катализировать реакцию.

Молекулы РНК, способные к катализу, были названы рибозимами (по аналогии с энзимами, то есть белковыми ферментами). За их открытие в 1989 году Чек и Альтман были удостоены Нобелевской премии по химии.

Эти результаты не замедлили сказаться на теории происхождения жизни: "фаворитом" стала молекула РНК. В самом деле, была обнаружена молекула, способная нести генетическую информацию и вдобавок к этому катализировать химические реакции! Более подходящего кандидата для зарождения доклеточной жизни трудно было представить.

Сценарий развития жизни преобразовался. Вначале, по новой гипотезе, в условиях молодой Земли спонтанно появились короткие цепочки молекул РНК. Некоторые из них, опять же спонтанно, приобретали способность к катализу реакции собственного воспроизведения (репликации). Из-за ошибок при репликации некоторые из дочерних молекул отличались от материнских и обладали новыми свойствами, например, могли катализировать другие реакции.

Еще одно важнейшее свидетельство того, что "вначале была РНК", принесли исследования рибосом. Рибосомы — структуры в цитоплазме клетки, состоящие из РНК и белков и отвечающие за синтез клеточных протеинов. В результате их изучения было выявлено, что у всех организмов именно РНК, находящаяся в каталитическом центре рибосом, отвечает за главный этап в сборке белков — соединение аминокислот между собой. Открытие этого факта еще более упрочило позиции сторонников РНК-мира. Действительно, если спроецировать современную картину жизни на ее возможное начало, разумно предположить, что рибосомы — структуры, специально существующие в клетке, чтобы "расшифровывать" код нуклеиновых кислот и производить белок, — появились когда-то как комплексы РНК, способные к соединению аминокислот в одну цепочку. Так на основе мира РНК мог появиться мир белков.

Совсем недавно были сделаны наблюдения, приведшие к еще одной сенсации. Оказывается, РНК не только катализирует химические реакции, но и защищает клетки растений и низших животных от вторжения вирусов. Эту функцию выполняет особый класс РНК — так называемые короткие, или малые, РНК, названные так потому, что их длина обычно не превышает двадцати одного "звена"-нуклеотида. У высших животных, например у млекопитающих, малые РНК также не остаются без работы и могут участвовать в регуляции считывания генной информации с хромосом. (Подробнее о малых РНК, открытие которых в 2002 году, по мнению одного из ведущих научных журналов — "Science", стало "прорывом года", можно почитать на сайте российской Научной Сети www.nature.ru.)

Как видим, имеется много достаточно веских теоретических доводов, чтобы считать молекулу РНК основоположницей жизни на Земле. В 1989 году нобелевский лауреат по химии Уолтер Гилберт, придумавший в свое время один из первых методов "побуквенного чтения" (секвенирования) ДНК, ввел в оборот выражение "мир РНК", имея в виду полноценный, самостоятельный и способный к эволюции мир доклеточной жизни.

Однако все ли так безоблачно и ясно в гипотезе о "мире РНК"? Ситуация перестанет казаться столь однозначной, как только мы немного углубимся в детали…

МИР РНК И ЭВОЛЮЦИЯ В ПРОБИРКЕ

Основой, доказательной базой современной биологии служит эксперимент. Но как доказать экспериментально существование процессов, происходивших на Земле миллиарды лет назад? И как восстановить ход эволюции за все это необозримое время? Пока наука не имеет в своем распоряжении машины времени, чтобы перенестись на четыре миллиарда лет назад. Ставить эксперимент протяженностью даже в несколько миллионов лет также вряд ли кому придет в голову. Поэтому ученые в своих гипотезах о происхождении жизни вынуждены использовать лишь косвенные данные, полученные физиками, геологами, математиками, биологами и палеонтологами при изучении развития Земли и Солнечной системы в целом.

Опираясь на наиболее правдоподобную версию о распределении на ранней Земле химических элементов и веществ, ее климате, ученые строят догадки и компьютерные модели тех процессов, которые могли привести к образованию первых биологических молекул. А иногда им даже удается проверить свои предположения на практике.

Что же необходимо доказать, чтобы построить теорию возникновения жизни на ее молекулярном (доклеточном) этапе? Перечислим некоторые наиболее важные вопросы.

Во-первых, важно знать, возможно ли было в условиях молодой Земли спонтанное образование основных "строительных блоков" нуклеиновых кислот — нуклеотидов. Далее, в случае гипотезы РНК-мира, следует доказать, что возникшие нуклеотиды были способны иногда спонтанно объединяться в небольшие цепочки — олигонуклеотиды. Затем хорошо бы продемонстрировать, что у некоторых из таких цепочек может появиться каталитическая активность, причем самое главное, чтобы это была способность копировать (воспроизводить) самих себя. Рассмотрим все эти вопросы по порядку.

Большинство ученых сейчас сходятся во мнении, что около четырех миллиардов лет назад атмосфера Земли представляла собой в основном смесь паров воды, метана, углекислого газа, водорода и аммиака. Из-за отсутствия кислорода ультрафиолетовое излучение Солнца было тогда гораздо интенсивнее современного, так как на его пути не было защитного озонового слоя (озон — продукт реакций молекул кислорода между собой). Как предположили ученые, перечисленных химических компонентов могло быть вполне достаточно, чтобы под воздействием солнечного ультрафиолетового излучения или электрических разрядов проходили химические реакции.

В 1953 году американский исследователь Стенли Миллер поставил несложный эксперимент. В собранной им установке он создал условия, схожие с атмосферой молодой Земли. Пропуская через полученную газово-водяную смесь электрические разряды, Миллер обнаружил, что через несколько суток образовалось множество органических молекул и, что самое важное, среди них присутствовали сахара и простейшие аминокислоты. Через несколько лет было показано, что при добавлении в газовую смесь цианидов (которые также вполне могли присутствовать в атмосфере молодой Земли) можно получить и азотистые основания, участвующие в построении нуклеотидов. Таким образом была экспериментально продемонстрирована возможность синтеза "исходного материала" для нуклеиновых кислот и белков.
(https://scisne.net/ax/d1/2/a2398/10.jpg)
В начале 1950-х годов Стенли Миллер из Чикагского университета (США) проделал первый эксперимент, моделирующий химические реакции, которые могли протекать в условиях молодой Земли.

Однако у подобных экспериментов есть несколько "узких мест", споры по которым не утихли до сих пор. Во-первых, некоторые ученые сомневаются в том, что относительно высокие концентрации цианидов и метана, применявшиеся в экспериментах Миллера и его последователей, могли быть достижимы в условиях молодой Земли. Во-вторых, количество сахара рибозы, производимой в ходе таких опытов и совершенно необходимой для построения РНК, было ничтожно мало. В-третьих, кроме "нормальных" азотистых оснований и сахаров получались и побочные продукты, которые могли мешать образованию "стандартных" нуклеотидов и молекул РНК.

Последователи теории РНК-мира пытаются усовершенствовать реакции и подобрать условия, позволяющие преодолеть указанные недостатки. Например, удалось добиться, чтобы именно рибоза являлась преобладающим сахаром в продуктах одной из таких модифицированных реакций.
(https://scisne.net/ax/d1/2/a2398/13.jpg)
Некоторые продукты, полученные в опытах Стенли Миллера

Следующее уязвимое место теории — возможность образования нуклеотидов из азотистых оснований, рибозы и фосфатов. Оказалось, что эффективность таких реакций и вероятность случайного синтеза "правильных" нуклеотидов очень мала.

Но допустим, что каким-то образом благодаря особым условиям, существовавшим на первобытной Земле, эти препятствия могли быть преодолены и в распоряжении Природы имелся достаточный запас нуклеотидов. Могли ли они спонтанно объединяться в хотя бы небольшие, короткие отрезки нуклеиновых кислот? Эксперименты свидетельствуют, что в водной фазе такое событие чрезвычайно маловероятно. И даже если это происходит, большинство таких коротких цепочек неверно строит свой сахарофосфатный остов.

Выходом из данной ситуации, как считают, мог стать так называемый твердофазный синтез, когда реакции объединения нуклеотидов в цепочки проходят не в растворе, а на поверхности какого-либо твердого вещества. Так, к слову, проводят искусственный синтез цепочек олигонуклеотидов для научных и медицинских целей. На первобытной Земле возможные кандидаты для "твердой фазы" — минеральные породы в глубине океана, такие, как карбонат кальция, каолинит, цеолиты, монтмориллонит. Твердая минеральная подложка не только способствует правильной ориентации нуклеотидов относительно друг друга, но и стабилизирует структуру образующегося олигонуклеотида. Кроме того, минеральные породы, возможно, могли активно накапливать нуклеотиды и образующиеся цепочки, позволяя им тем самым чаще встречаться и вступать в химические реакции.

Как показали результаты исследований, в таких условиях короткие цепочки могли объединяться в более длинные, состоящие из 20-30 звеньев, а это уже давало основание для опять-таки случайного, некаталитического образования первых рибозимов. Какими же свойствами должен был обладать первый появившийся РНК-фермент? Как раз на этом этапе ученых подстерегало еще одно труднопреодолимое препятствие.

Хотя выяснить, как все происходило на самом деле, нам вряд ли удастся, можно с уверенностью полагать, что основным свойством появившихся рибозимов должна была быть способность к ферментативному воспроизводству (копированию) окружавших их молекул РНК. В этом случае многократно повышалась бы скорость синтеза (а значит, и концентрация в окружающей среде) молекул РНК. Из некоторых впоследствии могли получиться рибозимы с другими полезными для эволюции свойствами, например со способностью к направленному синтезу нуклеотидов или аминокислот. Копируя все (или некоторые) молекулы РНК, такой ключевой рибозим (он называется РНК-репликазой) мог бы воспроизводить и собственные копии. Таким образом мог возникнуть самодостаточный и самовоспроизводимый мир РНК. Однако доказать такую возможность оказалось очень непросто.

Дело в том, что первые рибозимы, открытые Чеком и Альтманом, могли производить лишь одну операцию: вырезание и сшивку определенных участков в… самих себе. Эта процедура критически необходима для процесса так называемого "созревания РНК", в детали которого мы здесь не станем углубляться. Через несколько лет ученые продемонстрировали способность рибозимов к соединению аминокислот в белках, о которой мы уже упомянули выше. Однако сколько ни бились последователи теории РНК-мира, выделить из клеток или вирусов рибозим, который мог бы копировать РНК, не удалось. И хотя копирование РНК на РНК-матрице существует у некоторых вирусов, за эту реакцию отвечают только белки. Как же доказать, что РНК когда-то тоже была способна к копированию самой себя?

На помощь ученым пришла идея искусственного отбора. Подобно селекционерам животных и растений, они научились "обучать" молекулы РНК не характерным для природных рибозимов способностям и из тысяч и миллионов различных молекул РНК отбирать те, которые лучше справляются с поставленной задачей.

Идея метода, о котором пойдет речь, зародилась в конце 60-х годов XX века, когда в связи с открытиями бурно развивающейся молодой науки — молекулярной биологии ученые задались целью проверить справедливость эволюционных законов Дарвина для бесклеточных систем. Пионером в этом направлении стал американский ученый Сол Шпигельман, который путем искусственного отбора (в пробирке) получил организм, совершенно не похожий на своего "родителя".

Исходным организмом в данном случае служил вирус, состоявший из цепочки РНК и нескольких белков. В пробирке, где вирусу были предоставлены все необходимые компоненты для синтеза РНК, он через некоторое время изменился до неузнаваемости. То, что получилось в итоге, стали называть "шпигельманским монстром" — так разительно непохож он был на своего предка. И неудивительно: ведь у "монстра" в столь благоприятных условиях больше не было необходимости заражать клетки: все, что нужно для жизни, было у него "под рукой". Необходимость в белках, служащих для внедрения в клетку и размножения внутри нее, отпала. В результате мутаций в пробирке вирусная РНК, состоявшая изначально из 4500 нуклеотидов, укоротилась до 220, потеряв при этом все участки, кодировавшие белки вируса. Этот отрезок РНК и был тем "монстром", который накапливался в пробирке в результате высокой скорости своего копирования: ведь чем короче РНК, тем быстрее ее можно скопировать и тем больше копий получится в единицу времени.

Важным следствием эксперимента Шпигельмана было то, что вне организма, создав (или убрав) условия для изменчивости и отбора молекул РНК, можно проводить процесс, очень похожий на эволюционный. И хотя в опыте с "монстром" Шпигельман продемонстрировал скорее "деградацию" организма, последователи, развившие этот подход, назвали его методом "эволюции в пробирке" или иначе — "селекс-методом".
(https://scisne.net/ax/d1/2/a2398/08.jpg)

Схема процесса 'эволюции в пробирке' (селекс-метод).

Вкратце метод в его современной постановке заключается в получении цепочки РНК, ее мутировании (изменении длины цепочки или состава нуклеотидов), отборе вариантов, которые лучше других справляются с поставленной задачей, их копировании (размножении) в пробирке и снова искусственном мутировании, после чего цикл повторяется.

В итоге нескольких таких последовательных циклов удалось получить рибозимы с множеством не свойственных им изначально функций. Самым важным открытием в этой области стали исследования американских ученых под руководством Дэвида Бартеля, который в начале текущего века получил рибозим, способный специфически катализировать копирование РНК на РНК-матрице. Сущность этого процесса состоит в следующем. К имеющейся одноцепочечной РНК сначала должен прикрепиться небольшой участок комплементарной РНК. Рибозим (репликаза) присоединя ется к одному из концов такого участка и, выждав, пока к свободному основанию на копируемой цепи подойдет комплементарный ему нуклеотид из раствора, присоединяет его к концу растущей цепи, а затем продвигается на шаг вперед. Так, шаг за шагом, на старой цепи РНК растет новая, "дочерняя" цепь. Точность и скорость копирования, осуществляемого рибозимом Бартеля, оставляли желать лучшего. Удалось копировать лишь цепочки длиной не более 14 нуклеотидов. Поэтому был предложен другой вариант работы древнейшего РНК-фермента, согласно которому он должен был уметь лишь "сшивать" концы цепочек РНК. Такая лигазная (соединяющая) активность наблюдалась уже у первых рибозимов, выделенных Чеком и Альтманом. При этом не требуется система распознава ния "правильных" нуклеотидов при их пошаговом присоединении. Все, что необходимо, — уметь образовывать связи между двумя соседними свободными концами олигонуклеотидов, оказавшихся рядом случайно или "севших" на матричную (родительскую) цепь. Этот путь развития событий кажется более простым, а значит, и более вероятным.

Еще один рибозим, созданный Бартелем, обладал способностью присоединять молекулу сахара к азотистому основанию, что необходимо для образования нуклеотида. Так была практически продемонстрирована возможность образования рибозимов, способных катализировать два важнейших этапа образовании мира РНК: синтез нуклеотидов и их цепочек. Однако, оценивая факты более пристрастно, мы снова сталкиваемся с несколькими преградами на пути такого развития событий.

Во-первых, рибозимы осуществляют реакцию присоединения нуклеотидов очень неуверенно, так что при существовавших на первых этапах предполагаемого мира РНК низких концентрациях свободных нуклеотидов и олигонуклеотидов данная реакция просто бы не могла выполняться. Затем, в первобытном океане, несомненно, в больших концентрациях присутствовали вещества, затрудняющие (ингибирующие) или даже вовсе останавливающие реакцию рибозимного синтеза РНК, такие, как, например, соли тяжелых металлов или метаболиты, схожие с нуклеотидами и способные связываться с рибозимом, но неспособные встраиваться в растущую цепь РНК. И, наконец, наиболее критическое и до сих пор не преодоленное препятствие связано с наличием зеркально-симметричных вариантов биомолекул.

С зеркальной симметрией предметов мы сталкиваемся постоянно. Стоит сравнить между собой левые и правые ладони, ступни или уши. С одной стороны, они, безусловно, похожи. С другой — если вы попробуете мысленно совместить их в пространстве (или, что нагляднее, надеть левый ботинок на правую ногу), вы поймете суть явления, называемого в химии хиральностью. Оно заключается в невозможности совместить в пространстве молекулы, состоящие из одинаковых составляющих, которые расположены в разной пространственной ориентации по отношению к центральной молекуле. Практически это означает следующее: если к какому-либо из атомов данной молекулы прикреплены по крайней мере четыре различные химические группы, то возможно существование двух хиральных (зеркально-симметричных, как ладони руки) форм этой молекулы.

Луи Пастер (1822-1895) первым обнаружил, что кристаллы одного и того же вещества — винной кислоты — могут иметь две зеркально-симметричные пространственные конфигурации.

Впервые явление хиральности было открыто в середине XIX века великим Луи Пастером (1822-1895). Будучи молодым двадцатипятилетним ученым, он исследовал причину отложения солей винной кислоты (называемых "тартар") на стенках винных бочек. Решая такую сугубо утилитарную задачу, Пастер неожиданно обнаружил, что при нагревании тартар теряет присущее ему свойство вращать плоскость поляризации света. Еще более он был удивлен, когда оказалось, что химический состав и физические свойства измененного тартара оставались прежними. Исследовав кристаллы соли, Пастер заметил, что некоторые из них представляют собой зеркальное отражение других. Отделив кристаллы этих двух типов друг от друга, он обнаружил, что одни из них вращают плоскость поляризации света вправо, а другие — влево. Так было впервые показано, что одно и то же вещество может существовать в двух формах с различными оптическими свойствами.

Нуклеотидам также присуще это свойство: они могут существовать в форме, вращающей свет как влево (L-форма), так и вправо (D-форма). Однако особенность всех, без исключения, современных живых организмов состоит в том, что для построения своих нуклеиновых кислот они используют исключительно D-нуклеотиды. Присутствие даже малого количества L-форм нуклеотидов ингибирует (угнетает) или вовсе блокирует работу ферментов синтеза РНК, и особенно это справедливо для рибозимов, полученных Бартелем.

(https://scisne.net/ax/d1/2/a2398/11.jpg)
Хиральные молекулы, например аминокислоты, зеркально симметричны, как левая и правая рука. Сам термин 'хиральность' происходит от греческого слова 'хирос' — рука.

Почему природа выбрала именно D-, а не L-форму? Существовала ли данная избирательность с самого начала возникновения жизни? Если она образовалась в ходе эволюции, то что служило причиной? Как стало возможно обойти негативное влияние L-форм на первых этапах каталитического синтеза РНК? Почему на Земле не смог развиться "параллельный" L-нуклеотидный мир? На все эти вопросы пока не существует внятных ответов. (Об одной из гипотез, объясняющих преобладание биомолекул определенной симметрии, см. "Наука и жизнь" № 6, 2000 г. — Ред.)

ГИПОТЕЗЫ, ГИПОТЕЗЫ, ГИПОТЕЗЫ …

Как видим, теория РНК-мира пока полна противоречий и неясностей. Многие из них, безусловно, будут разрешены в рамках "классической" гипотезы, подразумевающей, что у истоков жизни стояла РНК, какой мы ее знаем в современном виде. Однако, учитывая все сложности на пути синтеза олигонуклеотидов, изложенные выше, можно понять Фреда Хойла, известного британского астрофизика и писателя, утверждавшего, что теория РНК-мира "столь же нелепа, как и предположение о возможности сборки "Боинга 747" ураганом, пронесшимся над мусорной свалкой".

(https://scisne.net/ax/d1/2/a2398/12.jpg)
Теория РНК-мира

В довершение всех проблем сторонников этой теории повергли в уныние свидетельства археологов и палеонтологов, обнаруживших остатки первых примитивных клеток в слоях, относящихся к периодам от 3,5 до 3,8 млрд лет тому назад. В то же время, считают, что жизнь не могла зародиться раньше, чем 4 млрд лет назад, так как до того времени Земля интенсивно "обстреливалась" метеоритами и кометами. По более радикальным данным, "обстрел" закончился еще позже — как раз около 3,8 млрд лет назад. Таким образом, времени для развития доклеточного мира практически не оставалось. С этим уже согласились видные сторонники и основатели гипотезы РНК-мира Томас Чек и Лесли Оргел.

Чтобы как-то разрешить все противоречия, многие ученые начинают склоняться к идее, что вместо относительно сложных азотистых оснований, присущих современным нуклеиновым кислотам, их предшественницы могли использовать слегка измененные варианты молекул, более склонные к реакциям нематричного синтеза. Некоторые из них, например аминогуанозин, способны без помощи ферментов объединяться в цепочки длиной до 20 нуклеотидов, что недостижимо при использовании обычного гуанозина. Более того, прототипы современных азотистых оснований могли быть и вовсе не циклическими молекулами, что упростило бы их синтез, взаимодействие с рибозой, а также, возможно, снизило бы их способность к угнетению первых появившихся "прото-рибозимов".

Существуют также экспериментальные данные о том, что древние проторибозимы могли состоять не из четырех, а всего из двух типов нуклеотидов, что значительно повысило бы вероятность их спонтанного образования и, следовательно, сократило бы время, необходимое для перехода доклеточного мира в клеточный.

Наконец, никто пока не может опровергнуть возможность занесения первых молекул жизни на Землю из космоса. Эта довольно популярная сейчас теория панспермии утверждает, что жизнь разносится по Вселенной в виде "спор". Ими можно считать органические соединения, иногда достаточно сложного строения, следы которых найдены в упавших на Землю метеоритах. По данным астрофизиков, органические вещества в значительных количествах существуют в газово-пылевых облаках и космической пыли, которая постоянно захватывается Землей.

Несмотря на высокую популярность идеи РНК-мира, сторонники белковой теории также не сдают свои позиции. Модифицировав представления Опарина, они утверждают, что короткие цепи из аминокислот (олигопептиды) могли синтезироваться с помощью РНК уже на ранних этапах РНК-мира (как мы видели, аминокислоты с легкостью образовывались в экспериментах Миллера и последователей). При этом такие олигопептиды могли принимать участие в катализе или защите и концентрировании первых рибозимов (например, путем упаковки их внутрь коацерватов). На практике было также показано, что пептидная (читай — белковая) цепь может служить заменителем сахарофосфатного остова в нуклеиновых кислотах. Подобные гипотезы намечают возможный способ перехода от мира РНК к миру белков и далее, к прото-клеточной эволюции.

Еще одна интересная и перспективная гипотеза состоит в том, что жизнь зарождалась вблизи выбросов горячих вулканических вод, где из-за температуры и наличия больших концентраций биогенных молекул реакции образования биомолекул могли происходить с более высокой скоростью (см. "Наука и жизнь" № 6, 2003 г. — Ред.). Кроме того, большие перепады температуры могли облегчать процессы матричного синтеза нуклеиновых кислот. Высокие температуры (вблизи источника) способствовали распаду двухнитчатых нуклеиновых кислот на однонитчатые, на которых вдали от источника (при понижении температуры) мог происходить следующий цикл синтеза. Такой сценарий напоминает разработанную в середине 80-х годов прошлого века технологию многократного копирования нуклеиновых кислот, названную полимеразной цепной реакцией (ПЦР). Возможно, человек просто повторил то, что Природа изобрела миллиарды лет назад?

В этой статье мы оставили за рамками вопрос возникновения другого носителя генетической информации — молекулы ДНК. Сейчас господствующей остается гипотеза более позднего возникновения ДНК, которая вытеснила РНК, зарекомендовав себя более надежным хранилищем генетической информации. Однако самые последние исследования показывают, что однонитчатая ДНК может служить даже лучшим ферментом, чем РНК. При этом, как мы уже знаем, ДНК гораздо более устойчива во внешней среде, что дает ей немалое преимущество. Кто знает, может быть, через несколько витков двойной спирали истории ДНК-мир, отвергнутый после открытия рибозимов, вновь отвоюет свои позиции.

По мере накопления знаний и развития методов исследования современные гипотезы и теории будут сменяться более правдоподобными и обоснованными. Однако на данном этапе развития науки кажется маловероятным, чтобы человечество смогло когда-либо окончательно разрешить эту тайну тайн. Несомненным остается лишь то, что человек никогда не отступится от ее разгадки. Ведь способность к познанию и изменению мира — та самая главная "мутация", которая движет одним из видов приматов последний миллион лет, подчиняя его воле всех бывших "родственников" и позволяя надменно именоваться "Царем Природы".

Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 22.09.2020, 23:46:44
Кандидат биологических наук С. Григорович
«Наука и жизнь» №2, 2004[/b][/i][/url]
Устарела эта бадья.
Уж и рибозимы друг друга копируют:

Трейси Линкольн и Джеральд Джойс из Скриппсовского института в Сан-Диего (Калифорния, США) в 2009 году сумели подобрать несколько пар рибозимов, которые размножают друг друга. В результате такой взаимной репликации популяция рибозимов может расти в геометрической прогрессии сколь угодно долго — для этого нужно только исправно снабжать растущую популяцию необходимыми «ресурсами», то есть исходными материалами для синтеза новых молекул РНК. За 30 часов популяция может в благоприятных условиях вырасти в 100 млн раз. Более того, заставив несколько разных пар размножающихся рибозимов конкурировать друг с другом за субстрат, исследователи вынудили их начать дарвиновскую эволюцию. В результате спонтанных мутаций и естественного отбора появились рекомбинантные рибозимы с повышенной скоростью размножения.
https://science.sciencemag.org/content/323/5918/1229

И проблема хиральности давно решена:
Проблема хиральной чистоты (https://www.hij.ru/read/articles/earth-science/2167/)

А вы все продолжаете вводить людей в заблуждение. Нехорошо... ::)

Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 23.09.2020, 01:56:27
Устарела эта бадья.
Уж и рибозимы друг друга копируют:

Трейси Линкольн и Джеральд Джойс из Скриппсовского института в Сан-Диего (Калифорния, США) в 2009 году сумели подобрать несколько пар рибозимов, которые размножают друг друга. В результате такой взаимной репликации популяция рибозимов может расти в геометрической прогрессии сколь угодно долго — для этого нужно только исправно снабжать растущую популяцию необходимыми «ресурсами», то есть исходными материалами для синтеза новых молекул РНК. За 30 часов популяция может в благоприятных условиях вырасти в 100 млн раз. Более того, заставив несколько разных пар размножающихся рибозимов конкурировать друг с другом за субстрат, исследователи вынудили их начать дарвиновскую эволюцию. В результате спонтанных мутаций и естественного отбора появились рекомбинантные рибозимы с повышенной скоростью размножения.
https://science.sciencemag.org/content/323/5918/1229

И проблема хиральности давно решена:
Проблема хиральной чистоты (https://www.hij.ru/read/articles/earth-science/2167/)

А вы все продолжаете вводить людей в заблуждение. Нехорошо... ::)

можно понять Фреда Хойла, известного британского астрофизика и писателя, утверждавшего, что теория РНК-мира "столь же нелепа, как и предположение о возможности сборки "Боинга 747" ураганом, пронесшимся над мусорной свалкой".
Все эти фантазии РНК-мира физикой помножаются на ноль, некоторые биологи прогуливали уроки физики, потому и несут чушь РНК-мира, выдавая свои желания и фантазии за действительную реальность. Всё это для лохов прогулявших занятия по физике. терапия красивая РНК-мира и химические реакции идут по определенным правилам иногда как часы швейцарские, пример принцип комплементарности, но с позиции физики молекула это материальная точка имеющая квантовую неопределенность координаты и импульса, её траектория размазана в пространстве, но если упростить до классической физики траектория это перенос из одной точки пространства в другую материальной точке и здесь начинает царствовать та самая случайность и неопределенность. физика не может обеспечить присоединение нужного нуклеотида к полинуклеотидной последовательности, всегда играет фактор случайности, для раствора только D-нуклеотиды вероятность ошибки при каждом новом присоединении равна 0,75.
Нуклеотидам могут существовать в форме, вращающей свет как влево (L-форма), так и вправо (D-форма). Однако особенность всех, без исключения, современных живых организмов состоит в том, что для построения своих нуклеиновых кислот они используют исключительно D-нуклеотиды. Присутствие даже малого количества L-форм нуклеотидов ингибирует (угнетает) или вовсе блокирует работу ферментов синтеза РНК, и особенно это справедливо для рибозимов, полученных Бартелем.

Не нужно выдавать желаемый бред РНК-мира за действительность, точно такой же бред о решении хиральной чистоты. процессы которые выдаются за реальные  гипотезе РНК-мира весьма и весьма маловероятные, такой бред РНК-мира по желанию биологов обретает статус естественной действительности, потому что они не понимают физики процесса. точно также как и вы игнорируете естественную малую вероятность, вы её переворачиваете с ног на голову и утверждаете о её реальности. Это  https://science.sciencemag.org/content/323/5918/1229 не доказательство РНК-мира, свойство РНК обратной репликацией. Мир  это сложный организм, а не обрывки беспорядочных полинуклеотидных коротких цепочек и не долго живущих.   
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 23.09.2020, 14:51:14
можно понять Фреда Хойла, известного британского астрофизика и писателя, утверждавшего, что теория РНК-мира "столь же нелепа, как и предположение о возможности сборки "Боинга 747" ураганом, пронесшимся над мусорной свалкой".
Разрешите повторить вам мой вопрос (#437), на который вы пока не ответили. Почему вы исключаете Бога из картинки?

Что невозможно природе, то возможно Богу! Сборка Боинга 747 ураганом - чудо точно такого же порядка, как море, расступившееся под действием урагана в точности тогда, когда это было нужно для спасения евреев. И таких случаев в Библии немало. Эпидемия, поразившая только первенцев и не затронувшая всех прочих, выглядит невероятной. Посох Аарона, который единственный из всех расцвел. Неожиданная гибель армии Санхерива под Иерусалимом. Примеров множество. Даже я, грешный, видел в Иерусалиме подобные невероятные чудеса, пусть и меньшего масштаба.

Кстати говоря, Баум в своем "Волшебнике из страны Оз" следует библейской логике: там ураган совершенно невероятным образом переносит домик именно так, чтобы убить злую колдунью. Почему же вы не рассматриваете такую возможность?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 23.09.2020, 18:47:17
можно понять Фреда Хойла, известного британского астрофизика и писателя, утверждавшего, что теория РНК-мира "столь же нелепа, как и предположение о возможности сборки "Боинга 747" ураганом, пронесшимся над мусорной свалкой".
Вы сели в лужу со статьей от 2004 года и после этого притаскиваете замусоленную цитату аж из 1982 года.
Браво, прекрасное решение! ;D
Цитировать
Все эти фантазии РНК-мира физикой помножаются на ноль, некоторые биологи прогуливали уроки физики, потому и несут чушь РНК-мира, выдавая свои желания и фантазии за действительную реальность. Всё это для лохов прогулявших занятия по физике. терапия красивая РНК-мира и химические реакции идут по определенным правилам иногда как часы швейцарские, пример принцип комплементарности, но с позиции физики молекула это материальная точка имеющая квантовую неопределенность координаты и импульса, её траектория размазана в пространстве, но если упростить до классической физики траектория это перенос из одной точки пространства в другую материальной точке и здесь начинает царствовать та самая случайность и неопределенность. физика не может обеспечить присоединение нужного нуклеотида к полинуклеотидной последовательности, всегда играет фактор случайности, для раствора только D-нуклеотиды вероятность ошибки при каждом новом присоединении равна 0,75.
Итак у нас знакомая картина. С одной стороны научные статьи и результаты экспериментов, а с другой стороны ваша бессвязная пурга.

Цитировать
Нуклеотидам могут существовать в форме, вращающей свет как влево (L-форма), так и вправо (D-форма). Однако особенность всех, без исключения, современных живых организмов состоит в том, что для построения своих нуклеиновых кислот они используют исключительно D-нуклеотиды. Присутствие даже малого количества L-форм нуклеотидов ингибирует (угнетает) или вовсе блокирует работу ферментов синтеза РНК, и особенно это справедливо для рибозимов, полученных Бартелем.
Напоминаю.

Уже через два года, после статьи Сазерленда, вышла статья группы Джейсона Хейна (Hein, J.E. et. al., «Nature Chemistry», 2011, 3, 704—706, doi:10.1038/nchem.1108, Hein, J.E., Blackmond, D.G., «Accounts of Chemical Research», 2012, 45, 12, 2045—2054, doi:10.1021/ar200316n). Добавляя к системе Сазерленда различные аминокислоты, они получили стереоспецифический синтез рибонуклеотидов. Более того, достаточно было 1% избытка одного из стереоизомеров аминокислот, чтобы в конце концов получились хирально чистые рибонуклеотиды! Аминокислоты вмешиваются в синтез Сазерленда на стадии реакции 2-аминооксазола с глицеральдегидом, причем образуется тройной продукт.
Проблема хиральной чистоты (https://www.hij.ru/read/articles/earth-science/2167/)

Цитировать
Не нужно выдавать желаемый бред РНК-мира за действительность, точно такой же бред о решении хиральной чистоты. процессы которые выдаются за реальные  гипотезе РНК-мира весьма и весьма маловероятные, такой бред РНК-мира по желанию биологов обретает статус естественной действительности, потому что они не понимают физики процесса. точно также как и вы игнорируете естественную малую вероятность, вы её переворачиваете с ног на голову и утверждаете о её реальности. Это  https://science.sciencemag.org/content/323/5918/1229 не доказательство РНК-мира, свойство РНК обратной репликацией. Мир  это сложный организм, а не обрывки беспорядочных полинуклеотидных коротких цепочек и не долго живущих.   
У вас есть аргументы, или только бессвязное бла-бла?
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 23.09.2020, 18:51:53
Разрешите повторить вам мой вопрос (#437), на который вы пока не ответили. Почему вы исключаете Бога из картинки?
Уважаемый Даниэль я не могу понять почему вы делаете такие выводы. Бог Творец, а материя творение, Бог первопричина, а всё что существует следствие. У жизни должна быть разумная, ане спонтанная причина. В такой термодинамической системе как Земля, действуют четкие правила химии при которых простые молекулы могут взаимодействовать в определенных логических направлениях определенными законами химии, пример принцип комплементарности. но молекулы в термодинамической системе движутся по хаотическим траекториям и нельзя точно предсказать координату и импульс материальной точки, слишком много факторов на неё действуют. Наблюдатель, ожидающий что в некоторый момент к полинуклеотидной цепи присоединится D-аденин ожидает это событие с вероятностью 0,125, это случайные процессы где Бог не предполагается. Когда ученые физики говорят о нелепости теория РНК-мира, они говорят о нелепости такой теории где нет Бога. Модест Матвеевич как раз такую научно популярную сказку и защищает. В своих постах я не раз выражал идею двух периодов в истории существования жизни, период Творческой активности и период Божественного покоя. В период Божественной активности материя энергия могла творится из ничего, то есть в дистиллированной дождевой воде из ничего сотворено или возникла клетка с ДНК,не важно вся сразу или путем от простого к сложному. В тот момент в момент творения клетки Бог точно знал координату и импульс каждой сотворенной частицы, и не только знал, но и управлял движением, целенаправленно двигал материальные точки в нужное место и нужное время, то есть управлял процессами сборки клетки. Как Он это делал не важно, нетварная Божественная первопричина определяет все свойство тварных следствий и их движений. В период Божественного покоя движения частиц  стали  механическими.             


Цитировать
Что невозможно природе, то возможно Богу! Сборка Боинга 747 ураганом - чудо точно такого же порядка, как море, расступившееся под действием урагана в точности тогда, когда это было нужно для спасения евреев. И таких случаев в Библии немало. Эпидемия, поразившая только первенцев и не затронувшая всех прочих, выглядит невероятной. Посох Аарона, который единственный из всех расцвел. Неожиданная гибель армии Санхерива под Иерусалимом. Примеров множество. Даже я, грешный, видел в Иерусалиме подобные невероятные чудеса, пусть и меньшего масштаба.
Правильно что Чудо, так как все описанные вами события произошли в период Божественного покоя, потому это чудо. В период абиогенеза творение клетки это сверхъестественный естественный процесс. Если Богу нужно создать множество обителей по всей вселенной, о вероятность возникновения жизни при сверхъестественном естественном процессе равна 1, а только при естественном процессе стремится к 0.   

Цитировать
Кстати говоря, Баум в своем "Волшебнике из страны Оз" следует библейской логике: там ураган совершенно невероятным образом переносит домик именно так, чтобы убить злую колдунью. Почему же вы не рассматриваете такую возможность?

Просто вы не читали мои посты, у вас нет перед очами ума контекста.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 23.09.2020, 19:07:02
Вы сели в лужу со статьей от 2004 года и после этого притаскиваете замусоленную цитату аж из 1982 года.

Модест Матвеевич уже прошло 38 лет, а вы до сих пор не поняли её смысла, почему физики считают шарлатанами биологов. Шарлатаны биологи типа вашего учителя Выбегалло из связки физика-химия-биология, выбрасывают аргументы физики в своих теориях, строя сказки только на связке химия-биология. Это он для вас шарлатанов и неучей от науки и общества показал на примере аэроплана. Вы до сих пор этого не в состоянии понять, почему жизнь без Бога чрезвычайно маловероятна. Профессор Выбегалло был дурак, зачем же ходить в дураках до сих пор опираясь на его авторитет демагога.       
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 23.09.2020, 19:35:19
.

Уже через два года, после статьи Сазерленда, вышла статья группы Джейсона Хейна (Hein, J.E. et. al., «Nature Chemistry», 2011, 3, 704—706, doi:10.1038/nchem.1108, Hein, J.E., Blackmond, D.G., «Accounts of Chemical Research», 2012, 45, 12, 2045—2054, doi:10.1021/ar200316n). Добавляя к системе Сазерленда различные аминокислоты, они получили стереоспецифический синтез рибонуклеотидов. Более того, достаточно было 1% избытка одного из стереоизомеров аминокислот, чтобы в конце концов получились хирально чистые рибонуклеотиды! Аминокислоты вмешиваются в синтез Сазерленда на стадии реакции 2-аминооксазола с глицеральдегидом, причем образуется тройной продукт.
Проблема хиральной чистоты (https://www.hij.ru/read/articles/earth-science/2167/)
У вас есть аргументы, или только бессвязное бла-бла?
Нуклеотидам могут существовать в форме, вращающей свет как влево (L-форма), так и вправо (D-форма). Однако особенность всех, без исключения, современных живых организмов состоит в том, что для построения своих нуклеиновых кислот они используют исключительно D-нуклеотиды. Присутствие даже малого количества L-форм нуклеотидов ингибирует (угнетает) или вовсе блокирует работу ферментов синтеза РНК, и особенно это справедливо для рибозимов, полученных Бартелем.
В природе, открытой системе если на одной стороне камня кристаллизовалась группа молекул(L-форма) сахара, то на другой стороне вероятностью 0,5 или 50:50 может образоваться группа молекул (D-форма) сахара, но когда пойдет дождь и вода накроет этот камень в этой луже обе формы сахара смешаются будет грязная смесь 50%:50% L- и D- изомеров. Теория эволюции в своих баснях игнорирует физику, и тем самым пытается превратить маловероятные события в 1. Этот прием работает только в научпопе для детей и лохов неучей. Биологи игнорирующие физику шарлатаны.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 23.09.2020, 19:36:48
Модест Матвеевич уже прошло 38 лет, а вы до сих пор не поняли её смысла, почему физики считают шарлатанами биологов.
А с чего вы взяли, что они так считают? Дадите ссылочку, или это было ваше очередное вранье? ;)

Цитировать
Шарлатаны биологи типа вашего учителя Выбегалло тз связки физика-химия-биология, выбрасывают аргументы физики в своих теориях, строя сказки только на связке химия-биология. Это он для вас шарлатанов и неучей от науки и общества показал на примере аэроплана.
Что за физические аргументы выбрасываются?
И не пишите снова ваши безграмотные глупости, давайте ссылки на физиков.
Цитировать
Вы до сих пор этого не в состоянии понять, почему жизнь без Бога чрезвычайно маловероятна. Профессор Выбегалло был дурак, зачем же ходить в дураках до сих пор опираясь на его авторитет демагога.     
Потому что, не существует никакого расчета вероятностей абиогенеза. То, что вы тут впариваете под видом этого есть глупость и ложь, я это уже объяснял.
Название: Re: Критерии искусственности объекта.
Отправлено: Святослав Вс от 23.09.2020, 19:57:12
Уважаемый Даниэль я не могу понять почему вы делаете такие выводы. Бог Творец, а материя творение, Бог первопричина, а всё что существует следствие. У жизни должна быть разумная, ане спонтанная причина. В такой термодинамической системе как Земля, действуют четкие правила химии при которых простые молекулы могут взаимодействовать в определенных логических направлениях определенными законами химии, пример принцип комплементарности. но молекулы в термодинамической системе движутся по хаотическим траекториям и нельзя точно предсказать координату и импульс материальной точки, слишком много факторов на неё действуют. Наблюдатель, ожидающий что в некоторый момент к полинуклеотидной цепи присоединится D-аденин ожидает это событие с вероятностью 0,125, это случайные процессы где Бог не предполагается. Когда ученые физики говорят о нелепости теория РНК-мира, они говорят о нелепости такой теории где нет Бога. Модест Матвеевич как раз такую научно популярную сказку и защищает. В своих постах я не раз выражал идею двух периодов в истории существования жизни, период Творческой активности и период Божественного покоя. В период Божественной активности материя энергия могла творится из ничего, то есть в дистиллированной дождевой воде из ничего сотворено или возникла клетка с ДНК,не важно вся сразу или путем от простого к сложному. В тот момент в момент творения клетки Бог точно знал координату и импульс каждой сотворенной частицы, и не только знал, но и управлял движением, целенаправленно двигал материальные точки в нужное место и нужное время, то есть управлял процессами сборки клетки. Как Он это делал не важно, нетварная Божественная первопричина определяет все свойство тварных следствий и их движений. В период Божественного покоя движения частиц  стали  механическими.             

Правильно что Чудо, так как все описанные вами события произошли в период Божественного покоя, потому это чудо. В период абиогенеза творение клетки это сверхъестественный естественный процесс. Если Богу нужно создать множество обителей по всей вселенной, о вероятность возникновения жизни при сверхъестественном естественном процессе равна 1, а только при естественном процессе стремится к 0.   

Просто вы не читали мои посты, у вас нет перед очами ума контекста.
Из неслучайности не обязательно следует Бог.
Если зарождение жизни такой сложный процесс, то насколько сложен должен быть ее создатель? Откуда он сам взялся, если он еще сложней и обладает разумом?
А если был всегда, то почему не может существовать некой "силы самоорганизации", которой не нужен интеллект?
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 23.09.2020, 20:46:19
Нуклеотидам могут существовать в форме, вращающей свет как влево (L-форма), так и вправо (D-форма). Однако особенность всех, без исключения, современных живых организмов состоит в том, что для построения своих нуклеиновых кислот они используют исключительно D-нуклеотиды. Присутствие даже малого количества L-форм нуклеотидов ингибирует (угнетает) или вовсе блокирует работу ферментов синтеза РНК, и особенно это справедливо для рибозимов, полученных Бартелем.
В природе, открытой системе если на одной стороне камня кристаллизовалась группа молекул(L-форма) сахара, то на другой стороне вероятностью 0,5 или 50:50 может образоваться группа молекул (D-форма) сахара, но когда пойдет дождь и вода накроет этот камень в этой луже обе формы сахара смешаются будет грязная смесь 50%:50% L- и D- изомеров. Теория эволюции в своих баснях игнорирует физику, и тем самым пытается превратить маловероятные события в 1. Этот прием работает только в научпопе для детей и лохов неучей. Биологи игнорирующие физику шарлатаны.
Вы, что, любезный, читать не умеете?

Достаточно небольшого перекоса, что бы в синтезе Сазерленда на выходе получились бы хирально чистые рибонуклеотиды.
 
Уже через два года, после статьи Сазерленда, вышла статья группы Джейсона Хейна (Hein, J.E. et. al., «Nature Chemistry», 2011, 3, 704—706, doi:10.1038/nchem.1108, Hein, J.E., Blackmond, D.G., «Accounts of Chemical Research», 2012, 45, 12, 2045—2054, doi:10.1021/ar200316n). Добавляя к системе Сазерленда различные аминокислоты, они получили стереоспецифический синтез рибонуклеотидов. Более того, достаточно было 1% избытка одного из стереоизомеров аминокислот, чтобы в конце концов получились хирально чистые рибонуклеотиды! Аминокислоты вмешиваются в синтез Сазерленда на стадии реакции 2-аминооксазола с глицеральдегидом, причем образуется тройной продукт.

Таким образом, достаточно, чтобы в синтез Сазерленда попал раствор аминокислот, хирально обогащенный путем частичной кристаллизации. В экспериментах Хейна так были получены хирально чистые рибонуклеотиды, начиная всего лишь с 1% хирально обогащенного пролина.
(https://hij.ru/upload/medialibrary/b9c/b9c8fe98993a2566e1f0286a430a19ab.jpg)
Такое небольшое хиральное обогащение аминокислот легко может быть обеспечено фотохимическими процессами с участием поляризованного УФ-света: как мы уже писали, в метеоритах встречаются аминокислоты с хиральным обогащением до 18%, причем с избытком именно L-изомеров.
Проблема хиральной чистоты (https://www.hij.ru/read/articles/earth-science/2167/)
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 23.09.2020, 21:04:18
Что невозможно природе, то возможно Богу!
[]
Почему же вы не рассматриваете такую возможность?

Чисто интересно, а как следует эту возможность рассматривать? Носить всегда пакет для сбора небесной манны, вдруг щас посыпется? Подъезжая к реке не искать лодку, а подождать пока река расступится?  :D
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 23.09.2020, 23:14:31
В природе, открытой системе если на одной стороне камня кристаллизовалась группа молекул(L-форма) сахара, то на другой стороне вероятностью 0,5 или 50:50 может образоваться группа молекул (D-форма) сахара, но когда пойдет дождь и вода накроет этот камень в этой луже обе формы сахара смешаются будет грязная смесь 50%:50% L- и D- изомеров. Теория эволюции в своих баснях игнорирует физику, и тем самым пытается превратить маловероятные события в 1. Этот прием работает только в научпопе для детей и лохов неучей. Биологи игнорирующие физику шарлатаны.
Печально, что вы вместо того чтобы ознакомится с научпопом по теме, продолжаете писать невежественную чепуху.
На ваших камнях может образовываться, что угодно, сахара в синтезе Сазерленда не нужны, там используются более простые органические молекулы (предшественники сахаров и нуклеотидов). Если исходный раствор аминокислот будет хотя бы с небольшим перевесом в левую сторону, рибонуклеотиды из него получатся только правые (левые глицеральдегиды будут связаны теми же аминокислотами и из них нуклеотиды не получатся).   
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 23.09.2020, 23:33:24
Чисто интересно, а как следует эту возможность рассматривать? Носить всегда пакет для сбора небесной манны, вдруг щас посыпется? Подъезжая к реке не искать лодку, а подождать пока река расступится?  :D
Зачем так глупо? :) Просто спросить у Бога, что Он собирается делать. И поступать соответственно.
Моисей же не наобум в воду полез, а потому, что Бог ему это сказал.
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 23.09.2020, 23:38:54
Зачем так глупо? :) Просто спросить у Бога, что Он собирается делать. И поступать соответственно.
Моисей же не наобум в воду полез, а потому, что Бог ему это сказал.

Жаль так мало людей следуют этому совету. :) А то какая бы настала красота, типа
- Боже, как нам от Ковида избавиться?
...
И все разом избавились.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 23.09.2020, 23:42:24
Уважаемый Даниэль я не могу понять почему вы делаете такие выводы. Бог Творец, а материя творение, Бог первопричина, а всё что существует следствие. У жизни должна быть разумная, ане спонтанная причина.
Потому, что вы спорите не с отсутствием Первопричины у всего мира, а конкретно с невозможностью естественного формирования РНК. То, что вы называете "разумной причиной" - это Причина для абсолютно всех явлений, от дождя до взрыва сверхновой. Жизнь здесь ничем особым не выделяется.

В такой термодинамической системе как Земля, действуют четкие правила химии при которых простые молекулы могут взаимодействовать в определенных логических направлениях определенными законами химии, пример принцип комплементарности. но молекулы в термодинамической системе движутся по хаотическим траекториям и нельзя точно предсказать координату и импульс материальной точки, слишком много факторов на неё действуют. Наблюдатель, ожидающий что в некоторый момент к полинуклеотидной цепи присоединится D-аденин ожидает это событие с вероятностью 0,125, это случайные процессы где Бог не предполагается. Когда ученые физики говорят о нелепости теория РНК-мира, они говорят о нелепости такой теории где нет Бога. Модест Матвеевич как раз такую научно популярную сказку и защищает.
Но вы же знаете, что Бог есть. А это значит, что все в мире происходит по установленным Им законам. Иначе говоря - естественным образом.

В своих постах я не раз выражал идею двух периодов в истории существования жизни, период Творческой активности и период Божественного покоя. В период Божественной активности материя энергия могла творится из ничего, то есть в дистиллированной дождевой воде из ничего сотворено или возникла клетка с ДНК,не важно вся сразу или путем от простого к сложному. В тот момент в момент творения клетки Бог точно знал координату и импульс каждой сотворенной частицы, и не только знал, но и управлял движением, целенаправленно двигал материальные точки в нужное место и нужное время, то есть управлял процессами сборки клетки. Как Он это делал не важно, нетварная Божественная первопричина определяет все свойство тварных следствий и их движений. В период Божественного покоя движения частиц  стали  механическими.             
Вообще-то Он и сейчас это делает.

В Библии, действительно, отмечено, что тот период, в которым мы находимся - седьмой День творения - отличается от предыдущих шести периодов тем, что Бог "зашабатился", условно говоря, воздерживается от активных преобразований мира. Но это не значит, что Он прекратил управление всем происходящим. Просто процессы на нашей планете временно перешли в стационарный режим, чтобы человеку была дана возможность подрасти и повзрослеть.

Но законы природы в этот День не изменились. Молекулы как двигались по своим траекториям согласно Божественным законам, так и двигаются. И, точно так же, если Богу нужно, чтобы случайные процессы привели к определенной закономерной цели, то Он это делает. В Библии масса примеров, на которые я вам указал.


Правильно что Чудо, так как все описанные вами события произошли в период Божественного покоя, потому это чудо. В период абиогенеза творение клетки это сверхъестественный естественный процесс. Если Богу нужно создать множество обителей по всей вселенной, о вероятность возникновения жизни при сверхъестественном естественном процессе равна 1, а только при естественном процессе стремится к 0.   

Просто вы не читали мои посты, у вас нет перед очами ума контекста.
Простите, я уже говорил, почему не читаю ваши посты... Уж очень они огромны.
Может быть, попробуете выразить вашу мысль в нескольких фразах, чтобы я смог ее понять?
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 23.09.2020, 23:45:12
Жаль так мало людей следуют этому совету. :) А то какая бы настала красота, типа
- Боже, как нам от Ковида избавиться?
...
И все разом избавились.
А вообще-то Бог и не скрывает, как :) Носить маски, например, и не приближаться друг к другу без крайней необходимости. Стоит всем людям мира чуть-чуть изменить свой образ жизни - и ковид исчезнет за несколько недель. Я читал такое мнение медиков.

Проблема в том, что это должны сделать все люди. Без исключений. А люди, увы, в массе своей не желают следовать этому совету. Достаточно 10-20% не желающих - и усилия всех остальных бесполезны.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 24.09.2020, 05:12:23
Из неслучайности не обязательно следует Бог.
Если зарождение жизни такой сложный процесс, то насколько сложен должен быть ее создатель?
В абиогенезе первой простейшей клетки в пространстве её объема под мембраной паралельно должны были идти независимые процессы формирования всех необходимых молекулярных механизмов и кодирование этих механизмов на полинуклеотидной цепи ДНК. Если каждый удачный молекулярный механизм по отдельности, возникал в разных галактиках, то ясно что собрать единую клетку невозможно, даже если такие процессы происходили в теплом внутреннем море на одной планете, расстояние между удачными ферментами может быть тысячи километров. Жизнь должна была формироваться под мембраной протоклетки. объём  моря настолько велик по сравнению с объемом протоклетки, что вероятность того что  удачный фермент возникший в море встретятся в объеме протоклетки равна отношению объёма клетки к объему моря  Vпк  / Vморе и это не затрагивает вероятность само возникновения работоспособного фермента, а таких известно 2000 различных видов, а для клетки нужны тысячи ферментов, не говоря уже о РНК. Случайное возникновение внутри протоклетки всего необходимого набора фактически равна нулю, единственное что может близкую к нулю вероятность сделать 1 это целенаправленный управляемый физический процесс доставки нуклеотида или аминокислоты в зону со пересечения электронных облаков на концах полинуклеотидных и полипептидных цепей и соответственно активных нуклеотидов и аминокислот соответственно. За процесс транспортировки нуклеотида в пространстве отвечает физика, материальная точка нуклеотид имеет координату и импульс, выбор пути при вариациях подчинён принципу наименьшего действия который определяет такой путь где разность между кинетической и потенциальной энергией минимальна. То есть на траекторию нуклеотида влияют внешние  воздействия других материальных точек. мы не можем точно знать какой нуклеотид первым присоединится к полинуклеотидной цепи. Если в первичной цитоплазме нуклеотиды в равной пропорции растворены и тщательно перемешаны, то вероятность удачной сборки максимальна, если пропорции неравные вероятность понижается. В целом вероятность возникновения работающего механизма самовоспроизводящегося автомата внутри протоклетки стремится к нулю в промежуток времени в котором все работающие молекулярные механизмы не разрушились от внешнего воздействия. Такой период не может быть миллионами лет, а скорость сборки полинуклеотидных цепей без ферментов катализаторов 1,5 нуклеотида в час.
дело в том что создатель должен обладать Разумом и направляющим действием, но тварный разум здесь не решение проблемы, так как тварный разум продукт Творца.           

Цитировать
Откуда он сам взялся, если он еще сложней и обладает разумом?
А кто вам сказал, что он ещё сложнее, если мы ничего незнаем о Его природе,не нужно его мереть категориями множества и интегральной сущностью. Вы скользите к пантеизму.

Цитировать
А если был всегда, то почему не может существовать некой "силы самоорганизации", которой не нужен интеллект?
известные силы организации материи связаны с законами физики и химии, причем физические законы стремятся к возрастанию энтропии, а правила химических соединений (пазлы) стремятся уменьшить энтропию, а разумное вмешательство в химические процессы еще сильней уменьшает энтропию. если мы научимся нанороботами доставлять молекулы в заданную точку пространства в заданное время, мы сможем создавать жизнь. Бог мог как творить молекулы из ничего, так и управлять их транспортировкой сверхъестественным способом.     
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 24.09.2020, 06:05:16
Потому, что вы спорите не с отсутствием Первопричины у всего мира, а конкретно с невозможностью естественного формирования РНК. То, что вы называете "разумной причиной" - это Причина для абсолютно всех явлений, от дождя до взрыва сверхновой. Жизнь здесь ничем особым не выделяется.
Бог первопричина всего и вся. Гранит имеет первопричину в Боге, лежал он себе 4,5 миллиарда лет как говорят ученые, пока человеку не пришла свободная творческая мысль, которая начала управлять его руками, руки создали под управлением мысли механизмы и человек взял и перенес с помощью механизмом гранит предварительно обработав, в одно выбранное место и построил прекрасный дворец. и сделал он это за один год. естественный ход событий делал так что гранит лежал миллиарды лет и не собирался превращаться во дворец ещё миллиарды лет. Таковы законы природы седьмого дня. Если вы наблюдаете законы природы сейчас, и пытаетесь постулировать симметрию законов относительно сдвига во времени, то есть перенести их в прошлое, то жизнь маловероятное событие фактически невозможное по современным законам, но если в прошлом Бог разумно управлял творческими законами, то есть или творил из ничего элементы жизни, транспортировал их в нужное место и нужное время, то эти процессы были тогда естественными, но если смотреть на них с позиции седьмого дня, божественного покоя, то по отношению к этим законам, где законы сохранения вещества и энергии сохраняются, те законы сверхъестественные. Я не отрицаю мир РНК, я отрицаю что этот мир созданный в фантазиях людей отрицающих божественную первопричину и не учитывающих маловероятность событий без участия вних Бога.     



Цитировать
Но вы же знаете, что Бог есть. А это значит, что все в мире происходит по установленным Им законам. Иначе говоря - естественным образом.
Вообще-то Он и сейчас это делает.
Быт.2:2 И совершил Бог к седьмому дню дела Свои, которые Он делал, и почил в день седьмый от всех дел Своих, которые делал.

Цитировать
В Библии, действительно, отмечено, что тот период, в которым мы находимся - седьмой День творения - отличается от предыдущих шести периодов тем, что Бог "зашабатился", условно говоря, воздерживается от активных преобразований мира. Но это не значит, что Он прекратил управление всем происходящим. Просто процессы на нашей планете временно перешли в стационарный режим, чтобы человеку была дана возможность подрасти и повзрослеть.
Законы сохранения энергии-материи работали всегда по воле Бога, даже в период творения Вселенной на ранних этапах это как бы костяк творения,на основании чего вселенная существует, но локальные нарушения законов сохранения целенаправленные Божественным разумом, позволило маловероятным событиям вытекающих из законов сохранения свершится с вероятностью 1. сейчас по воле Бога законы сохранения выполняются, но это не означает что они не могут быть локально нарушены Богом и свершится чудо сейчас. То что было в период божественной творческой активности естественным, произойди оно сейчас это стало бы чудом. В прошлом процессы били разумноестествеными, не случайными, сейчас это было бы сверхъестественным.     

Цитировать
Но законы природы в этот День не изменились. Молекулы как двигались по своим траекториям согласно Божественным законам, так и двигаются. И, точно так же, если Богу нужно, чтобы случайные процессы привели к определенной закономерной цели, то Он это делает. В Библии масса примеров, на которые я вам указал.
только сейчас они двигаются хаотично. А для возникновения жизни должны двигаться целенаправленно, вы называете это естественным я сверхъестественным, но по сути это одно и тоже, если первопричина всего Бог.

Цитировать
Простите, я уже говорил, почему не читаю ваши посты... Уж очень они огромны.
Может быть, попробуете выразить вашу мысль в нескольких фразах, чтобы я смог ее понять?
У вас тоже немаленькие.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 24.09.2020, 15:02:12
Бог первопричина всего и вся. Гранит имеет первопричину в Боге, лежал он себе 4,5 миллиарда лет как говорят ученые, пока человеку не пришла свободная творческая мысль, которая начала управлять его руками, руки создали под управлением мысли механизмы и человек взял и перенес с помощью механизмом гранит предварительно обработав, в одно выбранное место и построил прекрасный дворец. и сделал он это за один год. естественный ход событий делал так что гранит лежал миллиарды лет и не собирался превращаться во дворец ещё миллиарды лет. Таковы законы природы седьмого дня. Если вы наблюдаете законы природы сейчас, и пытаетесь постулировать симметрию законов относительно сдвига во времени, то есть перенести их в прошлое, то жизнь маловероятное событие фактически невозможное по современным законам, но если в прошлом Бог разумно управлял творческими законами, то есть или творил из ничего элементы жизни, транспортировал их в нужное место и нужное время, то эти процессы были тогда естественными, но если смотреть на них с позиции седьмого дня, божественного покоя, то по отношению к этим законам, где законы сохранения вещества и энергии сохраняются, те законы сверхъестественные. Я не отрицаю мир РНК, я отрицаю что этот мир созданный в фантазиях людей отрицающих божественную первопричину и не учитывающих маловероятность событий без участия вних Бога.     
Похоже, вы делаете некое различие между законами 7-го Дня и законами первых шести. Это ошибка: в Библии нет указаний на это. Различие тоньше.

Быт.2:2 И совершил Бог к седьмому дню дела Свои, которые Он делал, и почил в день седьмый от всех дел Своих, которые делал.
"Почил" - это неудачный перевод, в русском языке означает "уснул" или "умер". В Библии сказано - "ишбот", т.е. перешел в состояние Шабата, "зашабатился". Чтобы это правильно понять, нужно прежде всего знать, что означает слово Шабат.

А означает оно прекращение млахи, то есть (очень условно) активной деятельности, действий, меняющих окружающую действительность. Ни в коем случае это не сон, не смерть и даже не покой. Напротив, это очень интенсивная духовная работа. И вот как раз для того, чтобы дать человеку возможность активно работать, он освобождается от всей прочей деятельности: сельского хозяйства, строительства, написания книг и прочего. В Йом Киппур, Шабат шабатов, человек освобождается даже от еды и питья.

Как видите, смысл совершенно иной и не имеет никакого отношения к законам природы. Законы природы никогда не изменялись с момента сотворения мира. Изменилось другое - способ взаимодействия Бога с миром. А именно, ненадолго (очень ненадолго, всего несколько тысячелетий) Бог приостановил преобразование планеты и сосредоточился на диалоге с только что сотворенным человеком. Это седьмой День.

Законы сохранения энергии-материи работали всегда по воле Бога, даже в период творения Вселенной на ранних этапах это как бы костяк творения,на основании чего вселенная существует, но локальные нарушения законов сохранения целенаправленные Божественным разумом, позволило маловероятным событиям вытекающих из законов сохранения свершится с вероятностью 1. сейчас по воле Бога законы сохранения выполняются, но это не означает что они не могут быть локально нарушены Богом и свершится чудо сейчас. То что было в период божественной творческой активности естественным, произойди оно сейчас это стало бы чудом.
Бог, конечно, может все, в том числе и нарушить Свои законы, но Он никогда этого не делает. Все чудеса, как в первые шесть дней, так и сегодня - это разумное использование Богом Своих законов, а не нарушение их.

В прошлом процессы били разумноестествеными, не случайными, сейчас это было бы сверхъестественным.   
только сейчас они двигаются хаотично. А для возникновения жизни должны двигаться целенаправленно, вы называете это естественным я сверхъестественным, но по сути это одно и тоже, если первопричина всего Бог.
Согласно моей информации и моему опыту изучения Торы, нет никаких изменений в естественности процессов. Они и были, и остаются разумноестественными - и при этом в полном научном смысле случайными. Между расступившимся морем и образованием ДНК нет качественной разницы: и то, и другое "чудесно" лишь с точки зрения достижения цели, происходит же все это согласно законам природы.

Есть другие изменения, и очень существенные, но это уже отдельная тема. Если хотите, посмотрите в нашем курсе про 10 Дней творения в 9-м уроке. В этом же контексте я предлагал выше рассмотреть понятие искусственности. В масштабе проекта мироздания в целом есть шансы приблизиться к пониманию, в масштабе одного-единственного Дня и одного-единственного разумного вида - шансов практически нет (и все сводится к жонглированию терминами, что мы и наблюдали в этой теме).
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 24.09.2020, 16:37:20
А вообще-то Бог и не скрывает, как :) Носить маски, например, и не приближаться друг к другу без крайней необходимости. Стоит всем людям мира чуть-чуть изменить свой образ жизни - и ковид исчезнет за несколько недель. Я читал такое мнение медиков.

Проблема в том, что это должны сделать все люди. Без исключений. А люди, увы, в массе своей не желают следовать этому совету. Достаточно 10-20% не желающих - и усилия всех остальных бесполезны.

Дык я и говорю  - так мало людей слушают истинных пророков и богов. Каждый норовит своего какого-то , шайтан их забери.
Название: Re: Критерии искусственности объекта.
Отправлено: Михай Вадимович от 24.09.2020, 20:05:33
Дык я и говорю  - так мало людей слушают истинных пророков и богов. Каждый норовит своего какого-то , шайтан их забери.
Между религиями нет противоречий, но во всех них есть паршивые овцы - вольнодумцы-безмасочники.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 25.09.2020, 08:21:01
Как видите, смысл совершенно иной и не имеет никакого отношения к законам природы. Законы природы никогда не изменялись с момента сотворения мира. Изменилось другое - способ взаимодействия Бога с миром. А именно, ненадолго (очень ненадолго, всего несколько тысячелетий) Бог приостановил преобразование планеты и сосредоточился на диалоге с только что сотворенным человеком. Это седьмой День.
(https://sun9-36.userapi.com/pOAJKumBn317YQi1zGpv-k-yDZfvAG78N4kaSg/e1WfxT-hpis.jpg)


Цитировать
Законы природы никогда не изменялись с момента сотворения мира.
Пол Дирак излагал свою теорию, в которой законы изменялись, например, менялась величина гравитационной постоянной. А Лев Ландау не соглашался и говорил: Дирак - дурак.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 25.09.2020, 11:09:21
Пол Дирак излагал свою теорию, в которой законы изменялись, например, менялась величина гравитационной постоянной. А Лев Ландау не соглашался и говорил: Дирак - дурак.

К счастью в физике вопрос решается не тем, что думает Дирак или Ландау, а тем, как обстоят дела в реальности: наблюдение, измерения, эксперимент. Иначе физика ничем бы не отличалась от религии. До сих пор гравитационная постоянная считалась неизменной. Но открытие темной энергии и темной материи внесло в данной вопрос некоторою неясность с которой еще придется разбираться.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 25.09.2020, 11:16:51
А вообще-то Бог и не скрывает, как :) Носить маски, например, и не приближаться друг к другу без крайней необходимости. Стоит всем людям мира чуть-чуть изменить свой образ жизни - и ковид исчезнет за несколько недель.

Бог открыл сие ВОЗу, а ВОЗ - людям. Звучало это, наверное, так: "И возьми для маски своей голубого виссона 20 на 10 сантиметров, и пусть ткань сия будет, легка, плотна и добротна. И наложи маску сию на лице свое и вдыхай и выдыхай через нее размеренно. И да не вылетит из уст твоих ни слюны, ни какой иной жидкости и не внедрится в легкие ближних твоих. Дабы не быть тебе невольным убийцей ближних твоих в очах Моих."  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Сергей_54 от 25.09.2020, 13:10:38
Бог открыл сие ВОЗу, а ВОЗ - людям. Звучало это, наверное, так: "И возьми для маски своей голубого виссона 20 на 10 сантиметров, и пусть ткань сия будет, легка, плотна и добротна. И наложи маску сию на лице свое и вдыхай и выдыхай через нее размеренно. И да не вылетит из уст твоих ни слюны, ни какой иной жидкости и не внедрится в легкие ближних твоих. Дабы не быть тебе невольным убийцей ближних твоих в очах Моих."  :)

Иньшалла.
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 25.09.2020, 14:25:41
Пол Дирак излагал свою теорию, в которой законы изменялись, например, менялась величина гравитационной постоянной. А Лев Ландау не соглашался и говорил: Дирак - дурак.
Изменение постоянной - не изменение законов, а недостаточное знание законов. Вполне может быть, есть какие-то механизмы, влияющие на эту постоянную. Пока мы не располагаем единой теорией всех взаимодействий, ничего нельзя сказать наверняка.

Так, если ничего не знать про механизмы эволюции звезд, можно сказать, что изменение солнечной постоянной - "изменение законов".
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 25.09.2020, 14:30:05
Бог открыл сие ВОЗу, а ВОЗ - людям. Звучало это, наверное, так: "И возьми для маски своей голубого виссона 20 на 10 сантиметров, и пусть ткань сия будет, легка, плотна и добротна. И наложи маску сию на лице свое и вдыхай и выдыхай через нее размеренно. И да не вылетит из уст твоих ни слюны, ни какой иной жидкости и не внедрится в легкие ближних твоих. Дабы не быть тебе невольным убийцей ближних твоих в очах Моих."  :)
Не знаете Тору, так и не пытайтесь импровизировать :)
Бог сказал так: לֹא תַעֲמֹד עַל דַּם רֵעֶךָ
"Не стой при крови ближнего твоего".
А дальше - конкретное испытание и вопрос, возникающий из этого испытания: сможете ли справиться со своими привычками и выполнить заповедь? Проверка и отбраковка. Одна из самых начальных проверок перед переходом.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 25.09.2020, 20:12:30
Очередной пример логики.
Надо понимать, если фактов наличия Творца у нас нет, то существование его, даже случайное невозможно?
Так? ;)
Косвенные факты есть, та же семантика в ДНК, и.т.п.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 25.09.2020, 20:26:24
Вам необходим ликбез по русскому языку. "Как" это сравнение.
Фраза: "Ты, как слон", совсем не означает, что речь идет действительно слоне.

А, "машина как средство передвижения" это тавтология.
"Если ходит как утка, крякает как утка, выглядит как утка..." то это не утка?  :D

Сравнение частицей "как" не предполагает отрицание.

    Если вы утверждаете, что фраза "код ДНК, как семантика" не семантика вовсе. Вот и докажите на основание этих работ, что учёные вовсе не семантику имели ввиду, а что-то другое.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 25.09.2020, 20:35:53
Вам же писали  - отбор. Мутации могут ломать что угодно, отбор это из популяции убирает, остаются только особи с глазами. Причем особи у которых глаза лучше оставляют больше потомства, тем самым гены "хороших глаз" распространяются в популяции.
Мутации случайны. Преимущество проявляется при жизни организма. Геном, знаете ли, большой, мутации в нем случайны. Очень маловероятно, что бы в одном гене они происходили непрерывно из поколения в поколение.Естественно. Эволюция белков, как и эволюция органов это следствие эволюции генома. Собственно без эволюции белков никакие новые органы невозможны.
Но ведь мутации в особе, которая прошла отбор, никто не запретил. Мутации продолжаются и поэтому почему глаза вырастают всё время на голове, а не на пятке, не на спине ,и.т.д, каждый раз у новой особи? И это только местоположение органа. А есть варианты с его строением. Где все эти новые вариации от случайных мутаций?
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 25.09.2020, 20:50:53
Мембраны это уже эволюционное приобретение.
Ну и главные вопросы -

1. каким образом строение мембраны (и остальных элементов прото-клетки) записалось в код ДНК?

2. Каким образом колония из одноклеточных клеток записалась в код ДНК каждой клетки этой колонии, как цельный многоклеточный организм?  Обратите внимание на частицу "как", где по вашему ликбезу этот организм не должен быть многоклеточным?  :D
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 25.09.2020, 21:04:00
Постепенно. Путем эволюции.
(https://upload.wikimedia.org/wikipedia/commons/thumb/b/b6/Diagram_of_eye_evolution.svg/525px-Diagram_of_eye_evolution.svg.png)
https://ru.qwe.wiki/wiki/Evolution_of_the_eye (https://ru.qwe.wiki/wiki/Evolution_of_the_eye)
Прикольно. Осталось показать как мутация может вызывать переход от одной стадии к другой. Или хотя бы  указать ряд предков и потомков, реализующих эту последовательность. Иначе это просто красивая картинка.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 25.09.2020, 21:10:49
А как вы можете это доказать? Если науке неизвестен механизм естественного появления чего-либо, то это не значит, что его не существует.
Не существует механизма кодирования строения прото-клетки, для передачи его потомкам, а так же механизма передачи информации о колонии в ДНК одноклеточных, делая колонию единым организмом. Его учёные не обнаружили ни в одной клетки. Его не существует.

Простой пример: была липидная капля с жировой стенкой внутри которой плавала ДНК. Понятно, что в ДНК не было записано, что у этой капли надо строить жировую стенку, она возникала спонтанно из липидного раствора по закону физики. Но в один прекрасный момент стенка у капли вдруг изменилась, из липидной она превратилась в мембрану, из совершенно другого материала и при этом информация о построение оболочки капли оказалась запрограммирована в ДНК. И никакого механизма обратной связи между оболочкой и ДНК не обнаружено.

Далее с колонией клеток: в ДНК каждой клетки находилась информация только об одной клетки-хозяйки. И вдруг в ДНК каждой клетки попала информация о всей колонии, превратив эту колонию в единый организм. И опять, никакого механизма переноса информации о колонии в код ДНК одноклеточных не обнаружено. 
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 26.09.2020, 03:36:50
Ну и главные вопросы -
Модест Матвеевич Камноедов большой человек в НИИ ЧаВо, завхоз, у него в авторитете профессор Выбегалло, а он по свидетельству братьев Стругацких был дурак. Вы читали "Понедельник начинается с субботы".
 

Цитировать
1. каким образом строение мембраны (и остальных элементов прото-клетки) записалось в код ДНК?
Запись генетической информации в программе ДНК при абиогенезе без участия разумного манипулятора выбора и переноса молекул должна происходить спонтанно и независимо от спонтанной сборки ферментов. Без ферментов и РНК сама запись бесполезна. Ферменты и информация о них формировались двумя независимыми спонтанными процессами. вероятность таких удачных событий настолько мала, что при условии что эти процессы должны протекать в пространстве протоклетки в сроки, при которых  все удачные полипептидные цепи ферментов и полинуклеотидные цепи ДНК не распадутся. Скорость спонтанной сборки ДНК низкая, как показал эксперимент 1,5 нуклеотида в час. Это говорит нам что вероятность удачной сборки протоклетки как самовоспроизводящегося автомата практически стремится к нулю, нулевая. Так утверждает физика, биологи не держат с физикой, все их процессы абиогенеза такие как будто всеми процессами из под тишка управляет Бог, которого они делают вид что не замечают. В их воображении Бога нет, а процессы идут так как будто Он есть. Физика говорит нам что такие процессы как заявляют биологи без Бога невозможны в силу их чрезвычайно низкой вероятности, а биологи игнорируя физику в силу своей безбожной парадигмы школьникам и неучам лохам втирают что Бога нет,но процессы идут так как если бы он был. Этим как раз занимается Модест Матвеевич Камноедов, он игнорит физический аргумент, отрицает Бога, и втирает нам, что процессы идут так, как  если бы Бог был, но Его нет.
 

Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 26.09.2020, 03:48:58
Прикольно. Осталось показать как мутация может вызывать переход от одной стадии к другой. Или хотя бы  указать ряд предков и потомков, реализующих эту последовательность. Иначе это просто красивая картинка.
Такие мутации можно назвать редактированием и модифицированием генетической программы по ходу эволюции в условиях адаптации организма к изменившимся условиям среды обитания, кентерберийский взрыв тому показательный факт, но только Модест Матвеевич Камноедов пропагандист популизатор идей профессора Выбегалло, большой его фанат, отрицает бытие Редактора, но не редактуру, а то как спонтанные мутации это делают, как будто это делает редактор, которого нет он называет естественный процесс. Он не хочет видеть очевидное, а если человек не хочет, то зачем метать бисер? Он блокирует нехотением цепочку логических рассуждений.     
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 26.09.2020, 05:39:51
Модест Матвеевич Камноедов большой человек в НИИ ЧаВо, завхоз, у него в авторитете профессор Выбегалло, а он по свидетельству братьев Стругацких был дурак. Вы читали "Понедельник начинается с субботы".
 
Запись генетической информации в программе ДНК при абиогенезе без участия разумного манипулятора выбора и переноса молекул должна происходить спонтанно и независимо от спонтанной сборки ферментов. Без ферментов и РНК сама запись бесполезна. Ферменты и информация о них формировались двумя независимыми спонтанными процессами. вероятность таких удачных событий настолько мала, что при условии что эти процессы должны протекать в пространстве протоклетки в сроки, при которых  все удачные полипептидные цепи ферментов и полинуклеотидные цепи ДНК не распадутся. Скорость спонтанной сборки ДНК низкая, как показал эксперимент 1,5 нуклеотида в час. Это говорит нам что вероятность удачной сборки протоклетки как самовоспроизводящегося автомата практически стремится к нулю, нулевая. Так утверждает физика, биологи не держат с физикой, все их процессы абиогенеза такие как будто всеми процессами из под тишка управляет Бог, которого они делают вид что не замечают. В их воображении Бога нет, а процессы идут так как будто Он есть. Физика говорит нам что такие процессы как заявляют биологи без Бога невозможны в силу их чрезвычайно низкой вероятности, а биологи игнорируя физику в силу своей безбожной парадигмы школьникам и неучам лохам втирают что Бога нет,но процессы идут так как если бы он был. Этим как раз занимается Модест Матвеевич Камноедов, он игнорит физический аргумент, отрицает Бога, и втирает нам, что процессы идут так, как  если бы Бог был, но Его нет.
 
Вы правы, школьники, кто поступает на биофак, физикой и математикой в школе не интересуются и не понимают её толком, иначе поступали бы в инженеры.  :)

Они не могут понять даже простую теорию вероятности, и поэтому на полном серьёзе могут заявить, что вероятность зарождения жизни равна 1, потому как она таки возникла   :D
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 26.09.2020, 06:44:52
Такие мутации можно назвать редактированием и модифицированием генетической программы по ходу эволюции в условиях адаптации организма к изменившимся условиям среды обитания, кентерберийский взрыв тому показательный факт, но только Модест Матвеевич Камноедов пропагандист популизатор идей профессора Выбегалло, большой его фанат, отрицает бытие Редактора, но не редактуру, а то как спонтанные мутации это делают, как будто это делает редактор, которого нет он называет естественный процесс. Он не хочет видеть очевидное, а если человек не хочет, то зачем метать бисер? Он блокирует нехотением цепочку логических рассуждений.   

Знаете, никакого Редактора во всем этом не видят 90% ученых биологов профессионально занимающихся, в отличие от вас, всеми этим вопросами. Удивительно правда? Так что Выбегалло у нас - это скорее вы. Таких Выбегалл на самом деле очень много. Я не биолог. Но мне хорошо знакомы Выбегаллы  с пеной у рта доказывающие физикам, что СТО, например, это- ошибка.  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 26.09.2020, 07:33:41
Знаете, никакого Редактора во всем этом не видят 90% ученых биологов профессионально занимающихся, в отличие от вас, всеми этим вопросами. Удивительно правда? Так что Выбегалло у нас - это скорее вы. Таких Выбегалл на самом деле очень много. Я не биолог. Но мне хорошо знакомы Выбегаллы  с пеной у рта доказывающие физикам, что СТО, например, это- ошибка.  :)
С чего взЯли что 90% не видит? По статистикам около 40% учёных верят в Бога, соответственно 60% не видят Редактора.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 26.09.2020, 07:56:42
Знаете, никакого Редактора во всем этом не видят 90% ученых биологов профессионально занимающихся, в отличие от вас, всеми этим вопросами. Удивительно правда? Так что Выбегалло у нас - это скорее вы. Таких Выбегалл на самом деле очень много. Я не биолог. Но мне хорошо знакомы Выбегаллы  с пеной у рта доказывающие физикам, что СТО, например, это- ошибка.  :)
В науке политкорректность тоже имеет место.
Поэтому, если дают средства на исследования, то никто не будет спорить со спонсором: любой каприз за ваши деньги. Тем более, что в подавляющем большинстве случаев в идеологию лезть необязательно. Есть правда небольшая часть учёных, которые ради грантов и/или известности целенаправленно берут идеологически важные направления, и даже как Лики с их семейным подрядом подгоняют результаты под требуемые.


Кстати, СТО это не ошибка и не истина, а формализм (один из возможных, но по ряду причин удобный физикам-ядерщикам).
Название: Re: Критерии искусственности объекта.
Отправлено: Святослав Вс от 26.09.2020, 09:12:24
В абиогенезе первой простейшей клетки в пространстве её объема под мембраной паралельно должны были идти независимые процессы формирования всех необходимых молекулярных механизмов и кодирование этих механизмов на полинуклеотидной цепи ДНК...
Почему именно Бог, а не иной неслучайный способ?   
Критика абиогенеза тут лишняя.
Название: Re: Критерии искусственности объекта.
Отправлено: Святослав Вс от 26.09.2020, 09:14:59
Физика говорит нам что такие процессы как заявляют биологи без Бога невозможны в силу их чрезвычайно низкой вероятности, а биологи игнорируя физику в силу своей безбожной парадигмы школьникам и неучам лохам втирают что Бога нет,но процессы идут так как если бы он был. Этим как раз занимается Модест Матвеевич Камноедов, он игнорит физический аргумент, отрицает Бога, и втирает нам, что процессы идут так, как  если бы Бог был, но Его нет.
 
Что есть Бог с точки зрения физики? Не роль, а природа этого фактора.
Не неслучайность и не "это слишком сложно для самостоятельности", а именно Бог
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 26.09.2020, 09:22:30
Вы правы, школьники, кто поступает на биофак, физикой и математикой в школе не интересуются и не понимают её толком, иначе поступали бы в инженеры.  :)

Они не могут понять даже простую теорию вероятности, и поэтому на полном серьёзе могут заявить, что вероятность зарождения жизни равна 1, потому как она таки возникла   :D
наверное все школьники и студенты биофака смотрели Трансформеры и что вся эта организованная структура самовоспроизводящегося автомата цивилизации роботов трансформиров родственники предки нашим автомобилям и самолетам с пароходами, даже появилась высокоорганизованная куча железа с так называемым искусственном интеллектом.
Ну может десептиконов и автоботов школьники и студенты биофаков выпилили в кино, но куча высокоорганизованного железа с искусственным интеллектом существует как факт. Как рассказал ржавый десептикон его предок был колесом. А как известно первым продком автомобиля было колесо. Десептиконы-колёса эволюционировали в телегу, а телега в карету, а карета в автомобиль. Десептиконы появились как мы знаем из кино раньше чем люди, следовательно палка сама не могла эволюционировать в колесо. Люди как известно нашли десептиконов во льдах арктики и на Луне. Поняли что это древние машины, разобрали их поняли что первой детали было колесо вращающиеся на оси. поэтому мы можем сравнивать возникновение ферментов и рибосомы, молекулярных машин с механическими машинами с колесом. Если автомобиль существует на планете земля, то вероятность что мы его найдем равна 1. но эта вероятность ничего нам не говорит, о том как возник автомобиль из колеса, он просто есть. Вероятности в физике могут только стремится к 1 или 0. То что автомобиль существует нам  это говорит только что он есть, но не то как он появился, путем случайных стечений физических и химических обстоятельств, внешнее воздействие механической среды абразива и ветра обрабатывала кристаллические решетки, а расплавленная  лава из недр вулканов отливала заготовки пред обработкой их ветром и песком. Ну так наверное происходило зарождение машинной жизни десептиконов. или нет? кто то может сказать что первое колесо изобрел разум человека, и весь эволюционный процесс от колеса до автомобиля это инженерный процесс с участием инженеров. так во из вероятности 1 существования на земле автомобиля, вытекает то что к этой вероятности постепенно стремились физические и химические процессы в обоих случаях, только одни спонтанны под действием известных четырех стихий, другие под управлением разума инженера. Вероятность того что 4 древние стихии создадут автомобиль стремится к нулю, а автомобиль есть и это факт, то чтобы он стал не из говна и палок после того как ураган развалит свинарник, нужен инженер, научно техническая мысль которого разработает пошаговую технологическую карту всего управляемого процесса разработки и производства автомобиля. В эмбриогенезе тажа самая проблема потоки жидкости гоняют туда сюда гидрофобные и гидрофильные молекулы и вероятность того что из этого спонтанного вихреобразного движения молекул возникнет клетка и система организации клеток в живой организм также стремится к нулю, несмотря на то  что высокоорганизованная жизнь существует на земле с вероятностью 1. отсюда аналогичный вывод нужен инженер-генетик, способный как то обуздать вихревой хаос движений молекул в растворе воды. Инженер-генетик просто необходим чтобы вероятность возникновения жизни и её эволюция от 0 устремилась к 1.           
Название: Re: Критерии искусственности объекта.
Отправлено: Святослав Вс от 26.09.2020, 09:26:26
В науке политкорректность тоже имеет место.
Поэтому, если дают средства на исследования, то никто не будет спорить со спонсором: любой каприз за ваши деньги. Тем более, что в подавляющем большинстве случаев в идеологию лезть необязательно. Есть правда небольшая часть учёных, которые ради грантов и/или известности целенаправленно берут идеологически важные направления, и даже как Лики с их семейным подрядом подгоняют результаты под требуемые.


Кстати, СТО это не ошибка и не истина, а формализм (один из возможных, но по ряду причин удобный физикам-ядерщикам).
Кто заказчик "насаждения атеизма"?
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 26.09.2020, 09:51:30
Кто заказчик "насаждения атеизма"?
Не понял. Я упомянул атеизм?


Что касается финансирования, то, например, по текстовке передач о дикой природе видно, что авторам постоянно, к месту и не к месту, приходится упоминать эволюцию. Типа вместо "рыба/птица/зверь делает для выращивания детенышей то-то и то-то" надо говорить "эволюция выработала у такого-то такое-то поведение".
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 26.09.2020, 10:05:09
Знаете, никакого Редактора во всем этом не видят 90% ученых биологов профессионально занимающихся, в отличие от вас, всеми этим вопросами. Удивительно правда?

Так 100% ученых биологов профессионально занимающихся живой материей, трудятся над тем чтобы доказать что жизнь создана Богом, только 90% ученых биологов профессионально пытаются найти способ безбожной эволюции, на абиогенез они дружно забили неприличное слово. Они пытаются воссоздать жизнь в пробирке в лаборатории напрягая свой высокоорганизованный ум и технологии. То есть они сами того не осознавая в порыве творческого разумного энтузиазма хотят повторить опыт Бога. Конечно в этой грандиозной задаче Бог лишняя сущность, но на место Бога встал человек. Если человеку удастся создать из раствора активированных молекул живой организм это будет венец всех этих трудов и стремлений. Для этих амбициозных целей задействованы не только успехи химии, но и физики в форме сложнейших в технологическом плане лабораторий и инструментов. То что инженеры генетики изучают генетическую информацию, они учатся ей манипулировать, путем редактирования уже имеющийся генетической информации, производить инженерно индуцированные мутации. Уже давно выяснено что спонтанные мутации разрушают, а не созидают, потому что число плохих мутаций куда больше чем полезных хороших. Поэтому на абиогенез давно забили, но только в научно популярных статейках на бумаге гладок, а в реальности просто игнорируются овраги.     


Цитировать
Так что Выбегалло у нас - это скорее вы. Таких Выбегалло на самом деле очень много. Я не биолог. Но мне хорошо знакомы Выбегаллы  с пеной у рта доказывающие физикам, что СТО, например, это- ошибка.  :)
Вы не читали Стругацких. Тот логику демагогией подавлял, о Лысенко слыхали, от это прообраз Выбегалло. Вы физик, а логике предпочитаете демагогию. Вы как физик принципиально не включаетесь в дискуссию, потому что понимаете что физика и химия это не совсем одно и тоже, а демагоги тут пытаются строить жизнь только на правилах химии, где молекулы это пазлы, пример нуклеотиды, у них азотные основания так устроены по принципу пазлов или вилки и розетки, вы никогда не вставить трех фазную вилку в двухфазную розетку. На этом работает безупречно химический принцип комплементарности нуклеотидных пар. Физика отвечает  координату и импульс материальной точки нуклеотида, за его траекторию движения и вероятность того что в нужное время в нужном месте с нужной энергией окажется нужный нуклеотид. Демагоги и дураки типа Выбегалло ради своей идеологической установки из логике процесса выкидывает или игнорирует важный физический аргумент. Вы кстати уклоняетесь от логически обоснованной дискуссии, вы понимаете, что физика с ей вероятностями не в пользу идеологического аргумента строить модели абиогенеза только на химии и биологии, игнорируя физику процесса и вероятностный коэффициент в уравнение жизни.         

Евгений для построения математической модели частицы используют аппарат обобщенных функций, который создал раум Соболева, Соболев и не только спас Дирака от адских мук. Частица моделируется на ограниченном пространстве носителя финитных функций. Математика задает определение финитности функции, задавая граничные и начальные условия, и контролирует их заданность в своём уме. Все функции обнуляются на границах носителя финитных функций плотности. Границы эти своего рода непроницаемые  стенки объёмного сосуда, содержащие нечто. Финитная функция возникает когда функция плотности скажем функция нормального распределения Гаусса представленная в виде функции распространения Грина волей математика запирается внутри носителя, границы которого запирают распространение энергии в бесконечность, что иначе привело бы падению плотности энергии до нуля.   
(https://cf.ppt-online.org/files1/slide/a/a07z25AemndRwT9gqXsU4hoDk1GSbycliYVrfWB6x/slide-28.jpg)
 Математик своим волевым решением задает начальные и граничные условия. и наблюдает за их выполнением, за установленными правилами. Тоже касается и реальной Вселенной, чтобы она существовала на носителе Вселенной некого универсального множества,нужно задать начальные и граничные условия не только универсальному множеству, но и всем подмножествам и элементам множества этого множества и наблюдать выполнение этих правил. Бог Нужен для существования Вселенной как Математик нужен существования математической модели.     

 
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 26.09.2020, 10:21:25
Почему именно Бог, а не иной неслучайный способ?   
Критика абиогенеза тут лишняя.
Бог это разумный творческий принцип во Вселенной, не сводящейся у Вселенной. Я не о природе Бога, а о Его действиях по отношению к инобытию. Жизнь это чрезвычайно высокоорганизованная локализованная в пространстве материя, для ей организации нужны уровни бытия физический, химический и биологический, все эти уровни связаны единым уравнением, и на физическом уровне вероятностные коэффициенты, то есть числа отвечающие за вероятность события того или иного события нам говорят, что во Вселенной где царствуют законы физики, всякий неслучайный способ типа панспермия ведет нас через Большой взрыв к Богу.   
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 26.09.2020, 10:36:00
Кто заказчик "насаждения атеизма"?
Кам минимум Иван Карамазов «Если Бога нет, всё дозволено» квинтэссенция представляет собой краткую, но достаточно точную формулировку взглядов Ивана Карамазова,"…уничтожьте в человечестве веру в своё бессмертие, в нём тотчас же иссякнет не только любовь, но и всякая живая сила, чтобы продолжать мировую жизнь. Мало того: тогда ничего уже не будет безнравственного, всё будет позволено…". Человек хочет освободится от Бога, от психологической зависимости.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 10:46:54
Косвенные факты есть, та же семантика в ДНК, и.т.п.
Угу, только показать эту семантику, нивы  ни ваши коллеги не в состоянии. :)
Про "и т. п." с удовольствием послушаю. :D
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 10:50:47
"Если ходит как утка, крякает как утка, выглядит как утка..." то это не утка?  :D
Доказательством была бы демонстрация того, что то, что вы называете семантическим кодом непосредственно расположенo в живой системе.
Не на страничке учебника, не на глиняной дощечке и не в компюторной программе, а непосредственно в элементах живой системы.

Если вы этого продемонстрировать не можете, то всё, что вы можете, это озвучить своё персональное наблюдение:

"Живые системы ведут себя так, КАК БУДТО они содержат в своей структуре семантические коды"

Если вы понимаете, что "как будто содержат" и "содержат" это не одно и тоже, то проблем у меня с этим вашим наблюдением нет.
Но и никаких выводов о реальном наличии в живых системах семантических кодов я делать не могу. Нет у меня на это никаких оснований.
Ваши наблюдения - это не основания.

Цитировать
Сравнение частицей "как" не предполагает отрицание.
    Если вы утверждаете, что фраза "код ДНК, как семантика" не семантика вовсе. Вот и докажите на основание этих работ, что учёные вовсе не семантику имели ввиду, а что-то другое.
Я утверждаю, что никакую семантику пока никто не показал, значит и говорить не о чем.
Пока только идут попытки поймать ученых на слове, да и те проваливаются.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 11:13:31
Но ведь мутации в особе, которая прошла отбор, никто не запретил. Мутации продолжаются и поэтому почему глаза вырастают всё время на голове, а не на пятке, не на спине ,и.т.д, каждый раз у новой особи? И это только местоположение органа. А есть варианты с его строением. Где все эти новые вариации от случайных мутаций?
Вариации от случайных мутаций везде. В вашем геноме около 60-ти изменений по сравнению с геномом родителей.
Случаи о которых говорите вы также случаются, но крайне редко, и ,конечно, сразу вычищаются все тем же отбором.

Короче, полезно понимать, что отбор действует в каждом поколении.
 
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 11:16:15
Ну и главные вопросы -
1. каким образом строение мембраны (и остальных элементов прото-клетки) записалось в код ДНК?
2. Каким образом колония из одноклеточных клеток записалась в код ДНК каждой клетки этой колонии, как цельный многоклеточный организм?
Все тем же. Способом случайных мутаций.

Цитировать
0Обратите внимание на частицу "как", где по вашему ликбезу этот организм не должен быть многоклеточным?  :D
Это снова пример вашей тавтологии.
Типа, "машина, как транспортное средство". ;D
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 11:18:50
Прикольно. Осталось показать как мутация может вызывать переход от одной стадии к другой. Или хотя бы  указать ряд предков и потомков, реализующих эту последовательность. Иначе это просто красивая картинка.
Эта "красивая картинка" наглядно показывает, что такой сложный орган, как глаз мог возникнуть в результате небольших постепенных изменений. И на каждом этапе он приносил своему обладателю пользу.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 11:23:00
Не существует механизма кодирования строения прото-клетки, для передачи его потомкам, а так же механизма передачи информации о колонии в ДНК одноклеточных, делая колонию единым организмом. Его учёные не обнаружили ни в одной клетки. Его не существует.
Конечно, такой механизм нашли, это генно-регуляторные сети. Не в курсе, как обычно только креационисты.
Генные сети, управляющие строением тела животных (https://habr.com/ru/post/400905/)
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 11:33:56
Вы правы, школьники, кто поступает на биофак, физикой и математикой в школе не интересуются и не понимают её толком, иначе поступали бы в инженеры.  :)
Они не могут понять даже простую теорию вероятности, и поэтому на полном серьёзе могут заявить, что вероятность зарождения жизни равна 1, потому как она таки возникла   :D
Какие они глупые, эти биологи. Но, может быть, вы сможете указать на их ошибки?
Это пытался сделать Александр, но к сожалению, запутался в своей билиберде и ничего не смог. :(
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 11:37:18
С чего взЯли что 90% не видит? По статистикам около 40% учёных верят в Бога, соответственно 60% не видят Редактора.
Верят в Бога ученые в свободные от работы время.
Научных статей признающих необходимость "редакторов" не существует.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 11:40:45
В науке политкорректность тоже имеет место.
Поэтому, если дают средства на исследования, то никто не будет спорить со спонсором: любой каприз за ваши деньги. Тем более, что в подавляющем большинстве случаев в идеологию лезть необязательно. Есть правда небольшая часть учёных, которые ради грантов и/или известности целенаправленно берут идеологически важные направления, и даже как Лики с их семейным подрядом подгоняют результаты под требуемые.
То, что вы называете идеологией есть суть научного метода. Нельзя в науке объяснять необъясненное необъясненным, а тем более необъяснимым. Нельзя привлекать лишние сущности и тд. Иначе это сразу перестает быть наукой.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 26.09.2020, 12:54:19
То, что вы называете идеологией есть суть научного метода. Нельзя в науке объяснять необъясненное необъясненным, а тем более необъяснимым. Нельзя привлекать лишние сущности и тд. Иначе это сразу перестает быть наукой.
Суть научного метода - при подаче материала не ограничиваться известными фактами, а вставлять в научно-популярные передачи те самые "лишние сущности"? Это как раз идеология.
Как если бы на каждый факт прибавляли, что это Бог так устроил.
Честный учёный, если теория (хоть одна, хоть другая) не может быть верифицирована не будет рассматривать её как научную, а обойдётся фактами. Но по причине идеологического давления может формально признать требуемое (иначе работать не дадут). Это как в СССР для кошерности научной работы надо было непременно в начале вставить цитату из Ленина или Энгельса, такой вот был "научный метод".

Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 26.09.2020, 13:08:09
Суть научного метода - при подаче материала не ограничиваться известными фактами, а вставлять в научно-популярные передачи те самые "лишние сущности"? Это как раз идеология. Как если бы на каждый факт прибавляли, что это Бог так устроил.
Не понимаю о чем вы.
Цитировать
Честный учёный, если теория (хоть одна, хоть другая) не может быть верифицирована не будет рассматривать её как научную, а обойдётся фактами.
Это масло масляное. В науке теорией называется только то, что прошло верификацию. ТЭ это теория.
Цитировать
Но по причине идеологического давления может формально признать требуемое (иначе работать не дадут). Это как в СССР для кошерности научной работы надо было непременно в начале вставить цитату из Ленина или Энгельса, такой вот был "научный метод".
У вас есть доказательства такого давления? Примеры?
На самом деле, любой ученый мечтает что-нибудь опровергнуть. Причем чем глобальнее будет опровержение тем лучше. Тут тебе и почет и слава и признание. А на согласии не прославишься. 
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 26.09.2020, 16:27:58
В науке политкорректность тоже имеет место.
Поэтому, если дают средства на исследования, то никто не будет спорить со спонсором: любой каприз за ваши деньги. Тем более, что в подавляющем большинстве случаев в идеологию лезть необязательно. Есть правда небольшая часть учёных, которые ради грантов и/или известности целенаправленно берут идеологически важные направления, и даже как Лики с их семейным подрядом подгоняют результаты под требуемые.

Ну, да. Это широко распространенный обывательский взгляд на науку. Кроме того в обывательской среде циркулируют и разнообразные конспирологические теории о науке - представления о глобальных заговорах ученых, финансирующих науку организаций, которые-де заказывают музыку  и т.д.. Однако наука работает, конечно, совершенно не так. И забавно наблюдать, когда некий дилетант, черпающий свои знания о предмете из картинок, взятых из интернета, полагает, что лучше разбирается в сути вопроса, чем основная масса специалистов, занимающихся этими вопросами профессионально. 


Кстати, СТО это не ошибка и не истина, а формализм (один из возможных, но по ряду причин удобный физикам-ядерщикам).

Непонятно, что вы называете формализмом. СТО- это физическая теория - на сегодняшний день единственная возможная (альтернатив ей нет) - точно описывающая огромный массив наблюдаемых фактов нашей физической реальности. И не только в ядерной физики. Собственно, теория электро-магнетизма основана на СТО. Тем не менее, существует множество дилетантов (я лично с ними сталкивался), которые и здесь видят заговор и подвох. И яростно борются с СТО (как некоторые здесь воюют с ТЭ), даже не разбираясь в ней и не понимая, что это такое.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 26.09.2020, 16:34:18
Суть научного метода - при подаче материала не ограничиваться известными фактами, а вставлять в научно-популярные передачи те самые "лишние сущности"? Это как раз идеология.
Как если бы на каждый факт прибавляли, что это Бог так устроил.
Честный учёный, если теория (хоть одна, хоть другая) не может быть верифицирована не будет рассматривать её как научную, а обойдётся фактами. Но по причине идеологического давления может формально признать требуемое (иначе работать не дадут). Это как в СССР для кошерности научной работы надо было непременно в начале вставить цитату из Ленина или Энгельса, такой вот был "научный метод".

А может все гораздо проще? Может, в отличие от вас, ученые, профессионалы  просто хорошо видят, что ТЭ является настоящей научной теорией - и верифицируемой и фальсифицируемой? А вы, как и подобает воинствующему дилетанту предсказуемо скатываетесь на теорию заговора - (ученые, дескать, понимают, что ТЭ - это чушь, но кривят душой - потому, что иначе им денег не дадут). Как все это хорошо знакомо! :)
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 26.09.2020, 17:15:40
Непонятно, что вы называете формализмом. СТО- это физическая теория - на сегодняшний день единственная возможная (альтернатив ей нет) - точно описывающая огромный массив наблюдаемых фактов нашей физической реальности. И не только в ядерной физики. Собственно, вся теория электро-магнетизма основана на СТО.
Вы точно физик? Потому что физик как минимум бы знал, что "вся теория электромагнетизма" построена (Максвеллом) задолго до СТО и основана совсем на другом - на известных к тому времени законах электромагнетизма и работах Гельмгольца по гидродинамике.


СТО - система, основанная на метрике (Минковского) и преобразованиях координат (Лоренца), в которой достигается инвариантность скорости света относительно движущейся системы отсчёта и сохраняются размеры, перпендикулярные вектору относительной скорости. Альтернативных преобразований можно предложить аж целый континуум, только смысла в этом нет.


А может все гораздо проще? Может, в отличие от вас, ученые, профессионалы  просто хорошо видят, что ТЭ является настоящей научной теорией - и верифицируемой и фальсифицируемой?
Как собачка? Видят, а сказать не могут? Странного же Вы о них мнения.


Цитировать
[size=0px] [/size]А вы, как и подобает воинствующему дилетанту привычно скатились на теорию заговора - (ученые, дескать, понимают, что ТЭ - это чушь, но кривят душой - потому, что иначе им денег не дадут). Как все предсказуемо![size=0px] [/size]
[size=0px]А я просто много лет общаюсь с учёными (в основном по издательским делам, но не только) и имею представление о "кухне". И с идеями Куна о научных революциях тоже знаком.
"Теория заговора" - это для лохов.[/size]
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 26.09.2020, 17:38:08
Вы точно физик? Потому что физик как минимум бы знал, что "вся теория электромагнетизма" построена (Максвеллом) задолго до СТО и основана совсем на другом - на известных к тому времени законах электромагнетизма и работах Гельмгольца по гидродинамике.

Я точно физик и я в курсе, что теория Максвелла оказалась неинвариантной относительно преобразований Галилея (что противоречит классической механике), но является инвариантной относительно преобразований Лоренца. Кстати, вы в курсе, что то, что принято называть магнитным полем является релятивистским эффектом?

СТО - система, основанная на метрике (Минковского) и преобразованиях координат (Лоренца), в которой достигается инвариантность скорости света относительно движущейся системы отсчёта и сохраняются размеры, перпендикулярные вектору относительной скорости. Альтернативных преобразований можно предложить аж целый континуум, только смысла в этом нет.

Вы привели не вполне точнее определение СТО. Ну да ладно. Здесь это оффтоп. В декларации вашей готовности предложить "целый континнум" теорий эквивалентных СТО - узнаю безграничную самоуверенность дилетанта. Не будем это обсуждать.


Как собачка? Видят, а сказать не могут? Странного же Вы о них мнения.

:o И видят и говорят! Среди ученых биологов профессионально занимающихся данными вопросами научность ТЭ давно не предмет дискуссий.


[size=0px]А я просто много лет общаюсь с учёными (в основном по издательским делам, но не только) и имею представление о "кухне". И с идеями Куна о научных революциях тоже знаком.
"Теория заговора" - это для лохов.[/size]

Ну а я много лет работаю в науке и могут определенно сказать - ваши взгляды не соответствуют реальному положению вещей. В науке нет никаких идеологических заказов или предписаний. Если ученый увидит реальные, действительные основания для возможности опровержения какой-либо общепринятой, устоявшейся  теории - он будет более, чем счастлив это сделать и никакие идеологические ограничения его не остановят. 99% ученых биологов не видят причин подвергать научность ТЭ сомнению не по каким-то идеологическим причинам, а в силу осведомленности о ее (научности этой теории) реальных основаниях. Вот и все.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 26.09.2020, 18:09:40
Ну а я много лет работаю в науке и могут определенно сказать - ваши взгляды не соответствуют реальному положению вещей. В науке нет никаких идеологических заказов или предписаний. Если ученый увидит реальные, действительные основания для опровержения какой-либо общепринятой, устоявшейся  теории - он будет только счастлив это сделать и никакие идеологические ограничения его не остановят. 99% ученых биологов не видят причин подвергать научность ТЭ сомнению не по каким-то идеологическим причинам, а в силу осведомленности о ее (научности этой теории) реальных основаниях. Вот и все.
Если Вы работаете на своём узком участке, то могли просто не столкнуться с ограничениями. Но Вы же знаете: есть мнение научного сообщества, рецензенты публикаций  и т.п., поэтому без всяких специальных заговоров идеологические мотивы неизбежны. То, что Вы пишете, в значительной мере верно для математики, где, в частности, нельзя игнорировать контрпримеры.


Уже в физике ситуация несколько иная. Еретик, строящий теорию, отличную от устоявшихся (не опровергающий СТО, это дело маньяков), получает как минимум неодобрение. Например, Владимирову Юрию Сергеевичу (https://ru.wikipedia.org/wiki/Владимиров,_Юрий_Сергеевич), которого даже Вы вряд ли отнесёте к дилетантам, "научное сообщество" много нервов попортило.


В общественных же науках происходит прямое влияние идеологии, что видно хотя бы по недавнему советскому прошлому. И в РФ это присутствует. Профессор историк жаловался мне, что некоторые темы запретны. Опубликовать работы по ним можно (за свой счёт или в сети), но это значит похоронить научную карьеру.


Биология не настолько политизирована, как общественные науки, но в части ТЭ прямо их касается. Поэтому странно ожидать здесь объективного подхода.
Название: Re: Критерии искусственности объекта.
Отправлено: Святослав Вс от 27.09.2020, 07:43:26
Бог это разумный творческий принцип во Вселенной, не сводящейся у Вселенной. Я не о природе Бога, а о Его действиях по отношению к инобытию. Жизнь это чрезвычайно высокоорганизованная локализованная в пространстве материя, для ей организации нужны уровни бытия физический, химический и биологический, все эти уровни связаны единым уравнением, и на физическом уровне вероятностные коэффициенты, то есть числа отвечающие за вероятность события того или иного события нам говорят, что во Вселенной где царствуют законы физики, всякий неслучайный способ типа панспермия ведет нас через Большой взрыв к Богу.
Т.е. эта схема не обнаруживает Бога, а опирается на внешнюю идею и используется для объяснения непонятного и доказательства этой идеи?

Название: Re: Критерии искусственности объекта.
Отправлено: Святослав Вс от 27.09.2020, 07:46:47
Кам минимум Иван Карамазов «Если Бога нет, всё дозволено» квинтэссенция представляет собой краткую, но достаточно точную формулировку взглядов Ивана Карамазова,"…уничтожьте в человечестве веру в своё бессмертие, в нём тотчас же иссякнет не только любовь, но и всякая живая сила, чтобы продолжать мировую жизнь. Мало того: тогда ничего уже не будет безнравственного, всё будет позволено…".
Это не в этот раздел
И да - а зачем?
Человек хочет освободится от Бога, от психологической зависимости.
Т.е. это не поиск ответа, а использование идеи из другой сферы? Ну ясно, спасибо
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 27.09.2020, 11:30:03
Я точно физик и я в курсе, что теория Максвелла оказалась неинвариантной относительно преобразований Галилея (что противоречит классической механике), но является инвариантной относительно преобразований Лоренца. Кстати, вы в курсе, что то, что принято называть магнитным полем является релятивистским эффектом?
Магнитное поле создают не магнитные заряды, а движущиеся электрические заряды или токи. Оно трактуется не как самостоятельная физическая материальная сущность и даже не как одна из форм проявления электромагнитного поля, а лишь как процесс, релятивистский эффект, возникающий в пространстве, окружающем точечные заряды, вследствие конечной скорости передачи изменений величины электрического поля через пространство. Магнитного поля поэтому является чисто релятивистским эффектом, вследствие наличия в природе предельной скорости, равной скорости света в вакууме. Если бы эта скорость была бесконечной (соответственно и скорость распространения взаимодействий), никакого магнетизма вообще не существовало бы. Поля могут существовать только в присутствии корпускулярного источника, электрические и магнитные поля могут существовать только в присутствии зарядов.
Цитировать
:o И видят и говорят! Среди ученых биологов профессионально занимающихся данными вопросами научность ТЭ давно не предмет дискуссий.
причина в абиогенезе, научная дискуссия должна подчинятся принципу причинности, устанавливающему допустимые пределы влияния событий друг на друга. Нет обнадеживающих экспериментальных данных по абиогенезу, а бла бла бал... не имеет смысла, вот и не ведут научных дискуссий, доказать  экспериментально ТЭ-бла бла бал... не могут.     
Искусственные протоклетки синтезируют ДНК без помощи ферментов (https://elementy.ru/novosti_nauki/430749/Iskusstvennye_protokletki_sinteziruyut_DNK_bez_pomoshchi_fermentov)


Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 27.09.2020, 11:36:33
Цитировать
Цитата: Святослав Вс от Вчера в 09:26:26
Кто заказчик "насаждения атеизма"?

Это не в этот раздел
И да - а зачем?  Т.е. это не поиск ответа, а использование идеи из другой сферы? Ну ясно, спасибо

Человеку удобно жить в мире, где нет Бога. «Если Бога нет, всё дозволено».  Заказчик "насаждения атеизма" сам человек. 
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 27.09.2020, 12:25:10
Т.е. эта схема не обнаруживает Бога, а опирается на внешнюю идею и используется для объяснения непонятного и доказательства этой идеи?
Подобное познается подобным. Разумное познается разумным. Принцип причинности — один из самых общих физических принципов, устанавливающий допустимые пределы влияния событий друг на друга. Бог рассматривается как первопричина всего сущего. В силу ограничения наших экспериментальных возможностей мы не можем проследить полностью причинно-следственные связи событий, лежащих за пределами экспериментальных возможностей. по этой причине мы не знаем сути вещей. Мы не знает сути того что есть энергия. Мв наблюдаем феномен кванта энергии как следствие, но не видим причины этого следствия. Законы природы это тоже следствие ненаблюдаемой причины. Механический феномен законов природы как следствие должен иметь свою причину, Кто то должен наложить начальные и граничные условия на пространственный носитель корпускулы и надзирать над их выполнением, так проявляется феномен атома демокрита основа механической природы вещей. Тоже касается кванта действия размерность (энергия)х(время) и (координата)х(импульс). Механистические законы это следствие заданной причины, но причина может быть перезадана, и как следствие изменятся и законы. По одним причинам законы-следствия могут быть такими, что возникновение жизни это фактически невероятное событие, но по другим онтологическим причинам  законы-следствия могут быть такими, что возникновение жизни это фактически предрешенное событие с вероятностью 1. Так вот абиогенез на древней Земле протикал не по тем правилам причинам, что протекает в лаборатории сегодня. При этом первопричина это Бог, нет не старичок на облаке, как пытались показать научные атеисты, а разумная Первопричина всего сущего.         
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 27.09.2020, 12:50:22
А может все гораздо проще? Может, в отличие от вас, ученые, профессионалы  просто хорошо видят, что ТЭ является настоящей научной теорией - и верифицируемой и фальсифицируемой?
Молекулярная биология клетки. В 5-ти т. Т.1 Б.Албертс 1986
(https://sun9-17.userapi.com/GYyMghMikI-BVwQ8L1yRj3gTBMMiGBpOi1OdCA/5pRTMvvsUfI.jpg)
5 классных томов, а про абиогенез только это. Вся настоящая научность теорией в том что вероятность возникновения жизни объясняется большими размерами Земли и что на ней было много луж. Для лохов студентов биологов не знающих физики  может и прокатит.
(https://sun9-34.userapi.com/LN7fcB1EhN2-RZDrVFGFrF2hrtEfLHHzK_l5sQ/1IoSZdxCmac.jpg)
(https://sun9-44.userapi.com/laXt8DagCR4nxQajyXjoZ7xMWfNhhtfckp1zkg/7xmGxQUB0As.jpg)
Энциклопедический полная монография для биологов прогулявших пары по физики.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 27.09.2020, 14:51:28
Молекулярная биология клетки. В 5-ти т. Т.1 Б.Албертс 1986
5 классных томов, а про абиогенез только это. Вся настоящая научность теорией в том что вероятность возникновения жизни объясняется большими размерами Земли и что на ней было много луж. Для лохов студентов биологов не знающих физики  может и прокатит.
Энциклопедический полная монография для биологов прогулявших пары по физики.
Это 1986 год, 34 года назад! А современные статьи, вы игнорируете. >:(

Александр, ваши жалкие попытки обмануть собеседников ничего кроме чувства неловкости за вас вызвать не могут. Увы.

Цитировать
причина в абиогенезе, научная дискуссия должна подчинятся принципу причинности,
Ну и что? Эти два процесса: абиогенез и эволюцию живых организмов можно и нужно изучать по отдельности.

Цитировать
устанавливающему допустимые пределы влияния событий друг на друга. Нет обнадеживающих экспериментальных данных по абиогенезу, а бла бла бал... не имеет смысла, вот и не ведут научных дискуссий, доказать  экспериментально ТЭ-бла бла бал... не могут.     
Искусственные протоклетки синтезируют ДНК без помощи ферментов
Как обычно приводимые вами ссылки никак не подтверждают сказанное вами. Я вам уже объяснял о чем эта статья, если сами вы ее понять (или прочесть) не в состоянии, зачем вы продолжаете ссылаться на нее? ;D
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 27.09.2020, 15:29:24
Это 1986 год, 34 года назад! А современные статьи, вы игнорируете. >:(
(https://sun9-17.userapi.com/GYyMghMikI-BVwQ8L1yRj3gTBMMiGBpOi1OdCA/5pRTMvvsUfI.jpg)
про абиогенез в пятитомной энциклопедический монографии для биологов, на земле было много луж поэтому возникновение жизни на земле стало вероятным событием.  За 34 года ничего не изменилось.
 
Цитировать
Александр, ваши жалкие попытки обмануть собеседников ничего кроме чувства неловкости за вас вызвать не могут. Увы.
вы непорядочный человек.

Цитировать
Ну и что? Эти два процесса: абиогенез и эволюцию живых организмов можно и нужно изучать по отдельности.
эти два процесса взаимосвязаны причинно следственной связью.

Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 27.09.2020, 15:45:03
Не существует механизма кодирования строения прото-клетки, для передачи его потомкам, а так же механизма передачи информации о колонии в ДНК одноклеточных, делая колонию единым организмом. Его учёные не обнаружили ни в одной клетки. Его не существует.

Простой пример: была липидная капля с жировой стенкой внутри которой плавала ДНК. Понятно, что в ДНК не было записано, что у этой капли надо строить жировую стенку, она возникала спонтанно из липидного раствора по закону физики. Но в один прекрасный момент стенка у капли вдруг изменилась, из липидной она превратилась в мембрану, из совершенно другого материала и при этом информация о построение оболочки капли оказалась запрограммирована в ДНК. И никакого механизма обратной связи между оболочкой и ДНК не обнаружено.

Далее с колонией клеток: в ДНК каждой клетки находилась информация только об одной клетки-хозяйки. И вдруг в ДНК каждой клетки попала информация о всей колонии, превратив эту колонию в единый организм. И опять, никакого механизма переноса информации о колонии в код ДНК одноклеточных не обнаружено.
Смотрите, вы спорите не с тем, что я написал. Не будучи специалистом в биологии, я вообще не хочу углубляться в эти вопросы. Я лишь хотел обратить внимание на общее правило, которое не раз и не два подтверждалось в истории науки: если механизм неизвестен, это не значит, что его не существует. Возможно, через 200 или 20000 лет этот механизм будут изучать в школах.

Поскольку вы человек верующий, позвольте апеллировать к одному очень известному элементу нашей реальности: бессмертной душе. Мы с вами знаем, что душа существует, что после смерти некий фундаментальный элемент нашего Я сохраняется. При этом, разумеется, Я - носитель информации, причем очень значительной информации. Эта информация сохраняется, но не в нервных клетках, а в чем-то еще! Более того, это "что-то", вернее, "кто-то" после смерти получает возможность переместиться в миры, про которые науке вообще почти ничего неизвестно. Наука (неортодоксальная) уже сейчас пытается что-то узнать и про бессмертную душу, и про миры, куда она уходит после смерти. Нет ничего невозможного в том, что через какое-то время ученым удастся зафиксировать эту сущность с помощью приборов, взвесить, измерить и разобраться в механизмах хранения душой информации.

Так какие же основания считать, что ДНК не могла появиться с помощью какого-то механизма, неизвестного современной биохимии?
Название: Re: Критерии искусственности объекта.
Отправлено: Даниэль Алиевский от 27.09.2020, 15:51:41
Из неслучайности не обязательно следует Бог.
Если зарождение жизни такой сложный процесс, то насколько сложен должен быть ее создатель? Откуда он сам взялся, если он еще сложней и обладает разумом?
А если был всегда, то почему не может существовать некой "силы самоорганизации", которой не нужен интеллект?
Вы совершенно правы, уважаемый Святослав.

На самом деле все даже наоборот: из видимой неслучайности следует, что, скорее всего, предмет был создан каким-то разумным существом, тварью, но никак не Создателем всего. Потому что Бог - прежде всего Творец нашего мира, со всеми его естественными и случайными элементами. Он - Творец всех миллиардов миллиардов звезд, их планетных систем, всех атомов и молекул. Для Него просто нехарактерно творение чего-то такого, что мы воспринимаем как "неслучайное"!

Если что-то кажется неслучайным, то, скорее всего, оно создано кем-то, подобным нам. Например, другой цивилизацией или языческими богами (если принять гипотезу о языческих богах, которые, как известно, очень похожи на людей). А вот если мы видим эволюцию галактики - разумеется, абсолютно естественную! - то вот здесь уместно говорить о величии Творца.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 27.09.2020, 16:52:11
про абиогенез в пятитомной энциклопедический монографии для биологов, на земле было много луж поэтому возникновение жизни на земле стало вероятным событием.  За 34 года ничего не изменилось.
Разумеется, это наглая ложь. За 34 года наоткрывали очень много чего:

 - были открыты рибозимы, что позволило создать гипотезу РНК мира
 - решена проблема хиральности (Hein, J.E. et. al., «Nature Chemistry», 2011, 3, 704—706)
 - найден правдоподобный путь синтеза рибозим из простой органики (Powner, Gerland, Sutherland, «Nature», 2009, 459, 239—242)
 - найдены ртбозимы способные реплицировать короткие молекулы ДНК (Aniela Wochner, James Attwater, Alan Coulson, Philipp Holliger. Ribozyme-Catalyzed Transcription of an Active Ribozyme // Science. 2011. V. 332. P. 209–212)
 - доказанно, что пары рибозим способны  размножать друг друга, используя олигонуклеотиды в качестве исходного субстрата (Tracey A. Lincoln, Gerald F. Joyce. Self-Sustained Replication of an RNA Enzyme // Science. Published online January 8, 2009)

Цитировать
  вы непорядочный человек.
Почему? ::)
Цитировать
эти два процесса взаимосвязаны причинно следственной связью.
И что?

Цитировать
5 классных томов, а про абиогенез только это. Вся настоящая научность теорией в том что вероятность возникновения жизни объясняется большими размерами Земли и что на ней было много луж. Для лохов студентов биологов не знающих физики  может и прокатит.
Кстати про лохов биологов, которые ничего не понимают в физике, ага. Автором гипотезы РНК мира был ... фикик!

Мир РНК — гипотетический этап возникновения жизни на Земле, когда как функцию хранения генетической информации, так и катализ химических реакций выполняли ансамбли молекул рибонуклеиновых кислот. Впоследствии из их ассоциаций возникла современная ДНК-РНК-белковая жизнь, обособленная мембраной от внешней среды. Идея мира РНК была впервые высказана Карлом Вёзе в 1968 году, позже развита Лесли Орджелом и окончательно сформулирована Уолтером Гильбертом в 1986 году.
Гипотеза мира РНК (https://ru.wikipedia.org/wiki/%D0%93%D0%B8%D0%BF%D0%BE%D1%82%D0%B5%D0%B7%D0%B0_%D0%BC%D0%B8%D1%80%D0%B0_%D0%A0%D0%9D%D0%9A)

Уолтер Ги́лберт (англ. Walter Gilbert; род. 21 марта 1932 года, Бостон, США) — американский физик, биохимик и молекулярный биолог, лауреат Нобелевской премии по химии.
Гилберт Уолтер (https://ru.wikipedia.org/wiki/%D0%93%D0%B8%D0%BB%D0%B1%D0%B5%D1%80%D1%82,_%D0%A3%D0%BE%D0%BB%D1%82%D0%B5%D1%80)

Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 28.09.2020, 05:48:02
Конечно, такой механизм нашли, это генно-регуляторные сети. Не в курсе, как обычно только креационисты.
Генные сети, управляющие строением тела животных (https://habr.com/ru/post/400905/)
Они не кодируют ДНК, они включают-выключают разные гены, например "полового созревания" в нужный момент времени.

И эти сети идут в копилку аргументов за разумный замысел. Механизмы управления - это интеллектуальные системы информационного взаимодействия, для возникновения которых необходим разум. 
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 28.09.2020, 06:08:59
Разумеется, это наглая ложь. За 34 года наоткрывали очень много чего:

 - были открыты рибозимы, что позволило создать гипотезу РНК мира
 - решена проблема хиральности (Hein, J.E. et. al., «Nature Chemistry», 2011, 3, 704—706)
 - найден правдоподобный путь синтеза рибозим из простой органики (Powner, Gerland, Sutherland, «Nature», 2009, 459, 239—242)
 - найдены ртбозимы способные реплицировать короткие молекулы ДНК (Aniela Wochner, James Attwater, Alan Coulson, Philipp Holliger. Ribozyme-Catalyzed Transcription of an Active Ribozyme // Science. 2011. V. 332. P. 209–212)
 - доказанно, что пары рибозим способны  размножать друг друга, используя олигонуклеотиды в качестве исходного субстрата (Tracey A. Lincoln, Gerald F. Joyce. Self-Sustained Replication of an RNA Enzyme // Science. Published online January 8, 2009)
Почему? ::)И что?
Кстати про лохов биологов, которые ничего не понимают в физике, ага. Автором гипотезы РНК мира был ... фикик!

Мир РНК — гипотетический этап возникновения жизни на Земле, когда как функцию хранения генетической информации, так и катализ химических реакций выполняли ансамбли молекул рибонуклеиновых кислот. Впоследствии из их ассоциаций возникла современная ДНК-РНК-белковая жизнь, обособленная мембраной от внешней среды. Идея мира РНК была впервые высказана Карлом Вёзе в 1968 году, позже развита Лесли Орджелом и окончательно сформулирована Уолтером Гильбертом в 1986 году.
Гипотеза мира РНК (https://ru.wikipedia.org/wiki/%D0%93%D0%B8%D0%BF%D0%BE%D1%82%D0%B5%D0%B7%D0%B0_%D0%BC%D0%B8%D1%80%D0%B0_%D0%A0%D0%9D%D0%9A)

Уолтер Ги́лберт (англ. Walter Gilbert; род. 21 марта 1932 года, Бостон, США) — американский физик, биохимик и молекулярный биолог, лауреат Нобелевской премии по химии.
Гилберт Уолтер (https://ru.wikipedia.org/wiki/%D0%93%D0%B8%D0%BB%D0%B1%D0%B5%D1%80%D1%82,_%D0%A3%D0%BE%D0%BB%D1%82%D0%B5%D1%80)
Конец РНК мира: http://orthodoxy.cafe/index.php?topic=457517.0
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 28.09.2020, 06:14:39
Эта "красивая картинка" наглядно показывает, что такой сложный орган, как глаз мог возникнуть в результате небольших постепенных изменений. И на каждом этапе он приносил своему обладателю пользу.
Не, только вред. Например углубление на поверхности неминуемо заполнится всяким мусором по законам физики. А некое тело "аля хрусталик" будет мешаться, вызывая чесотку.
Название: Re: Критерии искусственности объекта.
Отправлено: Игорь Соколов от 28.09.2020, 06:23:00
Какие они глупые, эти биологи. Но, может быть, вы сможете указать на их ошибки?
Это пытался сделать Александр, но к сожалению, запутался в своей билиберде и ничего не смог. :(
Да полно, начиная от "полезный случайный перебор закрепляется отбором" до "углубление приносит пользу".
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 28.09.2020, 06:40:20
ДНК является единственной молекулой, которая способна к репарации.
Для ДНК характерно: Наличие большого числа репарационных систем. В клетках имеются белки, специально «патрулирующие» ДНК и осуществляющие поиск дефектов. Большинство репарационных систем удаляет не только сами поврежденные нуклеотиды, но и находящиеся рядом участки, т.е. удаляются секции поврежденных нуклеотидов. Поскольку ДНК – является двойной спиралью, то неповрежденная цепь служит матрицей для восстановления целостной молекулы ДНК.
Повреждения ДНК бывают:
1. Репарируемые и нерепарируемые.
2. Спонтанные и индуцированные.
3. Индуцируемые экзогенными факторами.
4. Индуцируемые эндогенными факторами.
Повреждения ДНК бывают:
1. Репарируемые повреждения удаляются собственными системами клеток, например, возникающие под действием УФ-лучей. Подавляющее большинство повреждений ДНК репарируются.
2. Нерепарируемые повреждения возникают редко.

Спонтанные повреждения возникают без каких либо направленных воздействий, а индуцированные – под действием физических, химических или биологических факторов.
Ежедневно в каждой клетке человека от 2 до 3 тыс. пуриновых и пиримидиновых нуклеотидов (на гаплоидный геном) теряют свои азотистые основания. В результате образуются АП-сайты (апуриновые и апиримидиновые). Сохраняется только дезоксирибоза и фосфодиэфирная связь.
Образование АП-сайтов
(https://cf.ppt-online.org/files/slide/4/4c6y2FmgfChzaJDHNsrLSWI130KTpbwEP7vGYd/slide-46.jpg)
(https://cf.ppt-online.org/files/slide/v/V40c9I3NgbyUXEG2unrApQliw1oJaCkfH7xPvs/slide-46.jpg)

К спонтанным повреждениям ДНК относится также дезаминирование азотистых оснований: цитозин - урацил.
(http://900igr.net/up/datas/76277/043.jpg)
Ежедневно в каждой клетке человека примерно 200 цитозинов (на гаплоидный геном) превращается в урацил. Кроме того: Аденин превращается в гипоксантин. Гуанин – в ксантин. Присоединение метильной СН3 -группы к углероду в 5-ом положении цитозина превращает его в тимин.
Ежедневно у человека возникает около 50 тыс. однонитевых разрывов, более 8 тыс. окисленных и алкилированных оснований, и еще в совокупности около 100 сложных повреждений (двунитевые разрывы, межмолекулярные ковалентные сшивки ДНК-ДНК и ДНК-белок).
Благодаря системе репарации из 1000 повреждений ДНК различного типа лишь 1 приводит к мутации.
Основные типы повреждения ДНК
1. Изменение структуры азотистых оснований: алкилирование (чаще всего метилирование с образованием 7-метилгуанина, 1-метиладенина, 6-Ометилгуанина, а также алкилированные производные тимина, аденина и цитозина);
2. Окисление азотистых оснований (образуется 8-окси-7,8- метилгуанин);
3. Гидролиз (дезаминирование, депуринизация, депиримидинизация);
4. Димеризация пиримидинов (чаще всего тиминов, реже цитозинов);
5. Разрыв цепей (одиночные и двойные разрывы);
6.Образование аддуктов (бензо[a]пирен диол эпоксид-dGаддуктов);
7. Межнитевые сшивки.
8. Сшивки ДНК-белок.




Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 28.09.2020, 12:34:51
Если Вы работаете на своём узком участке, то могли просто не столкнуться с ограничениями. Но Вы же знаете: есть мнение научного сообщества, рецензенты публикаций  и т.п., поэтому без всяких специальных заговоров идеологические мотивы неизбежны. То, что Вы пишете, в значительной мере верно для математики, где, в частности, нельзя игнорировать контрпримеры.

То, что я говорю верно для всех естественных наук, включая биологию, в которой основанием для каких-либо утверждений о реальности является научный метод (см. https://ru.wikipedia.org/wiki/%D0%9D%D0%B0%D1%83%D1%87%D0%BD%D1%8B%D0%B9_%D0%BC%D0%B5%D1%82%D0%BE%D0%B4 (https://ru.wikipedia.org/wiki/%D0%9D%D0%B0%D1%83%D1%87%D0%BD%D1%8B%D0%B9_%D0%BC%D0%B5%D1%82%D0%BE%D0%B4)). Вы правы в том, что существует мнение научного сообщества и рецензентов. И, может быть, при появлении какого-то принципиально нового взгляда на вещи приходится преодолевать некоторую инерцию. Однако, как показывает опыт, если этот новый взгляд научен, то весьма скоро он будет принят. Так было с квантовой механикой и с той же СТО, которые были настолько непривычны по-началу, что воспринимались многими с недоверием. Но в результате мы видим, что они стали основой современной физики.

Но ситуация с ТЭ иная. Подавляющее большинство ученых биологов не сомневаются в научности ТЭ. Они не видят причин считать естественные механизмы недостаточными для наблюдаемого в палеолетописи изменения форм жизни. Не видят необходимости в привлечении какого-то сверхъестественного фактора для описания этих изменений. ТЭ критика со стороны верующих идет не с научных позиций, а с идеологических. ТЭ неправильна просто в силу того, что в Библии написано, что Бог создал все живое, а ТЭ утверждает, что живое многообразие развивалось естественным путем. Однако, утверждения ТЭ подтверждаются многочисленными научными фактами и аргументами. Профессионалы биологи это понимают и именно поэтому среди критиков ТЭ так мало профессиональных биологов и так много дилетантов, не имеющих к биологии никакого отношения, не имеющих биологического, да и вообще какого-либо естественно научного образования, которым ничего не стоит заявить, например, что вся ваша гео и палео хронология полная чушь, Земле около 7000 лет и поэтому вся ваша ТЗ - ерунда.

И возникает презабавная ситуация: неучи учат ученых уму разуму в области их профессиональной деятельности.   


Уже в физике ситуация несколько иная. Еретик, строящий теорию, отличную от устоявшихся (не опровергающий СТО, это дело маньяков), получает как минимум неодобрение. Например, Владимирову Юрию Сергеевичу (https://ru.wikipedia.org/wiki/Владимиров,_Юрий_Сергеевич), которого даже Вы вряд ли отнесёте к дилетантам, "научное сообщество" много нервов попортило.

В физике теория не стоит бумаги на которой написана до тех пор, пока она не получит убедительное экспериментальное подтверждение. Бывает некоторые теоретики слишком увлекаются и уходят "в отрыв". Возможно с Владимировым именно тот случай.

В общественных же науках происходит прямое влияние идеологии, что видно хотя бы по недавнему советскому прошлому. И в РФ это присутствует. Профессор историк жаловался мне, что некоторые темы запретны. Опубликовать работы по ним можно (за свой счёт или в сети), но это значит похоронить научную карьеру.

Общественные науки вообще не являются науками, если под наукой понимать область деятельности с использованием указанного выше научного метода.

Биология не настолько политизирована, как общественные науки, но в части ТЭ прямо их касается. Поэтому странно ожидать здесь объективного подхода.

Не наблюдаю никакой политизации в биологии. Вижу только что подавляющий массив критики ТЭ является идеологически (религиозно) мотивированным, а отнюдь не научным. Сама ТЭ вполне научная теория, и так, без какой-либо идеологической подоплеки, считают подавляющее большинство биологов.
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 28.09.2020, 12:37:43
Да полно, начиная от "полезный случайный перебор закрепляется отбором" до "углубление приносит пользу".

Перевираете. Зачем? На самом деле: Случайные генетические мутации, приводящие к признакам, благоприятным для выживания организма в данной среде обитания, закрепляются в данной популяции естественным отбором. 
Название: Re: Критерии искусственности объекта.
Отправлено: Евгений О. от 28.09.2020, 12:45:09
научная дискуссия должна подчинятся принципу причинности, устанавливающему допустимые пределы влияния событий друг на друга. Нет обнадеживающих экспериментальных данных по абиогенезу, а бла бла бал... не имеет смысла, вот и не ведут научных дискуссий, доказать  экспериментально ТЭ-бла бла бал... не могут.     
Искусственные протоклетки синтезируют ДНК без помощи ферментов (https://elementy.ru/novosti_nauki/430749/Iskusstvennye_protokletki_sinteziruyut_DNK_bez_pomoshchi_fermentov)

Поэтому и нет теории абиогенеза. Есть только некоторые гипотезы, модели, идеи, рассуждения и т.д. Выше я вел речь не о абиогенезе, а о ТЭ.
Название: Re: Критерии искусственности объекта.
Отправлено: Владимир Витальевич от 28.09.2020, 12:56:21
В физике теория не стоит бумаги на которой написана до тех пор, пока она не получит убедительное экспериментальное подтверждение. Бывает некоторые теоретики слишком увлекаются и уходят "в отрыв". Возможно с Владимировым именно тот случай.
По содержанию работ ему не смогли ничего предъявить, хотя пытались.
Претензий собственно было две: 1. личная религиозность и связанная с этим общественная деятельность (например, участие в организации РЧ) и 2. положительная оценка некоторых идей Маха и дружба с "нерукопожатным" Кулаковым.
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 28.09.2020, 15:02:52
Поэтому и нет теории абиогенеза. Есть только некоторые гипотезы, модели, идеи, рассуждения и т.д. Выше я вел речь не о абиогенезе, а о ТЭ.

Механизмы контроля целостности ДНК
В клетке существует несколько чекпойнтов (сверочные точки повреждений ДНК):
1. Точка в G1 – проверяется интактность ДНК. Если ДНК содержит повреждения, вероятнее всего, клетки элиминируются путем р53-опосредованного апоптоза (p53 – экспрессирует белки - индукторы апоптоза, ингибиторов роста и ангиогенеза)
2. Точка в S-фазе – проверяется правильность репликации ДНК. Например, клетка останавливается в этой фазе при недостатке нуклеотидов в ДНК.
3. Точка в G2 – проверяются повреждения, пропущенные при прохождении предыдущих сверочных точек, либо полученные на последующих стадиях клеточного цикла. В G2 фазе детектируется полнота репликации ДНК, и если ДНК недореплицирована – клетка не входит в митоз.
4. Точка сборки веретена деления – проверяется прикрепление кинетохор к микротрубочкам.
Белки, принимающие участие в этой системе, по выполняемой роли разделяют на три группы: сенсоры, медиаторы, эффекторы.
В группу сенсоров входят белки, определяющие факт повреждения ДНК и вид повреждения. Предполагают, что эту функцию могут выполнять некоторые из белков комплекса репликации. Найдя повреждение, сенсорные белки передают информацию
посредникам, которые инициируют остановку клеточного цикла, запускают репарацию ДНК или апоптоз клетки.
Основными белками-медиаторами являются два консервативных белка-киназы ATM(Ataxia-Telangiectasia Mutated) и ATR (ATMRelated).
ATM и ATR связываются с поврежденным участком и фосфорилируют различные белки-мишени, например, BRCA1 и p53, которые и реализуют клеточный ответ.
Белок р53 постоянно присутствует в клетке в очень низкой концентрации. Постоянное разрушение белка в здоровой клетке обеспечивается белком Mdm2 (убиквитин-лигазой), направляющей р53 к протеасомам для разрушения. Фосфорилирование р53 после повреждения ДНК снижает его связывание с Mdm2 – снижается деградация р53, и его концентрация в клетке возрастает.
Белок BRCA1 взаимодействует с белками репарационных систем и стимулирует восстановление нормальной структуры ДНК. Одновременно индуцирует остановку клеточного цикла – усиливает активность р53 и активирует белки, останавливающие клетки в G1 и в G2-фазе клеточного цикла.


Евгений, иллюстрация приведенная выше, как много нужно белков ферментов, а науке известны 2000 ферментов, нужно было создать или случайно образоваться в условиях ранней Земли. Белок это полипептидная цепочка с двумя активными концами, куда могут быть присоединены аминокислоты. Свертывается белок в три фазы: с начало образуя первичную структуру саму полипептидную цепь аминокислотную нить. Все аминокислоты различаются радикалами, поэтому от того на коком месте в цепи стоит тот или иной радикал, зависит как будет свернута пространственная структура белка. Вторичная структура скручивает и ужимает нить в спираль, а третичная структура складывает эту спираль в объемную конструкцию, внутри которой образуются активные области с высокими каталитическим свойствами. С точки зрения физики при абиогенезе в протоклетке присоединение к обеим концам активированных аминокислот происходит спонтанно, поэтому первичная структура белка случайная, а нам нужно 2000 неслучайных сборки как минимум, при этом пока механизм ДНК не создан, для этого механизма нам нужно множество копей всех необходимых белков ферментов и они должны в одно время и в пространстве протоклетки образоваться и сработаться. Паралельно должно собраться всё необходимое сообщество РНК, и кто то должен прописать оба сообщества, и мира белков, и мира РНК в паспортном столе ДНК,на полинуклеотидной цепи ДНК должны случайным образом собраться в строго определенной последовательности нуклеотидов гены кодирующие белки и последовательности копирующие все виды РНК. Если биолог не понимает физику процесса движения молекул в растворе, не имеет представления как посчитать вероятность того, что к одному из активированных концов полипептидной цепи присоединится необходимая аминокислота, не случайная, а нужная аминокислота, то он спокойно может рассуждать о абиогенезе как о высоковероятном процессе, как будто Бог создает жизнь из тени, а раз Он в тени, то его как бы и нет. Если утверждаете небытие Бога, то по совести нужно утверждать возникновения жизни при абиогенезе близка к нулю.       
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 28.09.2020, 19:31:27
Они не кодируют ДНК, они включают-выключают разные гены, например "полового созревания" в нужный момент времени.
А, вы под "кодируют ДНК" что понимаете?
Цитировать
И эти сети идут в копилку аргументов за разумный замысел. Механизмы управления - это интеллектуальные системы информационного взаимодействия, для возникновения которых необходим разум.
Ага, у вас и вода под действием интеллектуального механизма управления информационного действия застывает и выстраивается в кристаллическую решетку строго при нуле градусов по Цельсию. Ага.  :D
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 28.09.2020, 19:32:31
Конец РНК мира: http://orthodoxy.cafe/index.php?topic=457517.0
Вы ветку читали?
Про "конец РНК мира" там ничего нет. Увы.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 28.09.2020, 19:38:42
Не, только вред. Например углубление на поверхности неминуемо заполнится всяким мусором по законам физики.
Правда? Ну расскажите про эти законы физики, например, Планариям, которые с такими "ямками" живут миллионы и миллионы лет.

Цитировать
А некое тело "аля хрусталик" будет мешаться, вызывая чесотку.
Вы в курсе, что такое тело "аля хрусталик" есть у каждого человека?
Прислушайтесь к своим ощущениям, чувствуете чесотку в районе глаз?  :)
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 28.09.2020, 19:47:41
Да полно, начиная от "полезный случайный перебор закрепляется отбором"
Что не так с отбором?
Цитировать
до "углубление приносит пользу".
Видите ли, в то время как плоские глазные повязки были неэффективны при определении направления света, поскольку луч света активировал точно такое же пятно светочувствительных клеток независимо от его направления, «чашечная» форма глазных ямок позволяла ограниченную дифференциацию по направлению, изменяя, какие клетки свет будет падать в зависимости от угла света.
Название: Re: Критерии искусственности объекта.
Отправлено: Модест Матвеевич от 28.09.2020, 22:17:06
Евгений, иллюстрация приведенная выше,
А ничего, что вся иллюстрация у вас про ДНК, а по современным научным представлениям результатом абиогенеза был РНК мир?

Цитировать
как много нужно белков ферментов, а науке известны 2000 ферментов, нужно было создать или случайно образоваться в условиях ранней Земли.
Вам неизвестно, что РНК обладает каталитической способностью? По аналогии с ферментами (англ. enzyme) РНК-катализаторы были названы рибозимами.
Цитировать
С точки зрения физики при абиогенезе присоединение к обеим концам активированных аминокислот происходит спонтанно, поэтому первичная структура белка случайная, а нам нужно 2000 неслучайных сборки как минимум, при этом пока механизм ДНК не создан, для этого механизма нам нужно множество копей всех необходимых белков ферментов и они должны в одно время и в пространстве протоклетки образоваться и сработаться.
Сможете процитировать специалиста или научное издание, которое с вами согласно? Что в процессе абиогенеза в протоклетке должно образоваться 2000 белков?
Это всего лишь ваши безграмотные фантазии.
Цитировать
Паралельно должно собраться всё необходимое сообщество РНК
,
Не параллельно, а до того. Не забываем про РНК мир.
Цитировать
и кто то должен прописать оба сообщества, и мира белков, и мира РНК в паспортном столе ДНК,на полинуклеотидной цепи ДНК должны случайным образом собраться в строго определенной последовательности нуклеотидов гены кодирующие белки и последовательности копирующие все виды РНК.
Сперва были РНК геномы, там все и прописывалось.
Цитировать
Если биолог не понимает физику процесса движения молекул в растворе, не имеет представления как посчитать вероятность того, что к одному из активированных концов полипептидной цепи присоединится необходимая аминокислота, не случайная, а нужная аминокислота, то он спокойно может рассуждать о абиогенезе как о высоковероятном процессе, как будто Бог создает жизнь из тени, а раз Он в тени, то его как бы и нет. Если утверждаете небытие Бога, то по совести нужно утверждать возникновения жизни при абиогенезе близка к нулю.       
Да-да, расскажите например сотрудникам Научно-исследовательского института физико-химической биологии имени А.Н.Белозерского (https://istina.msu.ru/organizations/department/276005/), как правильно понимать физику. :D
Название: Re: Критерии искусственности объекта.
Отправлено: Александр_52 от 30.09.2020, 13:31:11
Поэтому и нет теории абиогенеза. Есть только некоторые гипотезы, модели, идеи, рассуждения и т.д. Выше я вел речь не о абиогенезе, а о ТЭ.

Химическая кинетика является одним из важнейших разделов физической химии – науки об общих количественных закономерностях химических реакций и сопутствующих им физических процессов. Если первый раздел физической химии - химическая термодинамика - определяет принципиальную возможность протекания химической реакции, то второй ее раздел - химическая кинетика - рассматривает условия, в которых эта возможность превращается в действительность. Химическая кинетика изучает протекание реакций во времени и определяет условия, в которых образование продуктов происходит с достаточной скоростью. Для решения этой задачи необходимы сведения о механизме протекания реакции на атомно-молекулярном уровне, поэтому химическую кинетику определяют как нау-ку о скоростях и механизмах химических реакций.
Химическая кинетика изучает скорости и механизмы химических реакций. Оба эти понятия тесно связаны друг с другом. Рассмотрим химическую реакцию, которую в общем случае можно представить в следующем виде:
 v1 A1 + v2 A2 > v3 A3 + v4 A4 (I.1)
Для того чтобы реакция протекала слева направо, необходимо, чтобы v1 молекул реагента A1 и v2 молекул реагента A2 оказались в непосредственной близости друг с другом, так как только в этом случае станет возможен разрыв химической связи в исходных реагентах и образование молекул продуктов, то есть произойдет элементарный акт.

Скорость химической реакции определяется числом элементарных актов, протекающих в единицу времени в единице реакционного пространства. Если реакция протекает в гомогенной системе, то есть внутри одной фазы – газа или жидкости, реакционным пространством является объем (V). Если реакция протекает в гетерогенной системе, на границе раздела фаз, то в этом случае реакционным пространством является поверхность раздела фаз(S).
Непосредственно определить число элементарных актов не представляется возможным. Поэтому скорость химической реакции обычно выражают через величину, им пропорциональную: количество молей исходных веществ или продуктов (n), соответственно исчезнувших или образовавшихся за единицу времени в единице реакционного пространства. Как известно, химическая реакция протекает в соответствии с законом стехиометрии, согласно которому


-dn1/v1= - dn2/v2= dn3/v3= dn4/v4= ± - dni/vi=dξ , (I.2)
где ni - количество молей исходных реагентов или продуктов реакции, vi - стехиометрический коэффициент, ξ – число пробегов химической реакции (другое название – химическая переменная). Стехиометрический коэффициент – коэффициент, стоящий перед символом или формулой вещества в химическом уравнении, отражающий относительное количество участвующих в реакции веществ.

По UPAC скорость химической реакции выражается как
r=dξ/dt    (I.2’)
Если гомогенная реакция протекает в закрытой системе при постоянном объеме, то ее скорость (r) выражается следующим образом:

r= ±dni/Vvidt. (I.3)
Для гетерогенной реакции в закрытой системе при постоянной поверхности раздела фаз имеем:
r= ±dni/Svidt.. (I.4)
Величина ni/V = ci есть мольно-объемная концентрация. Поэтому для гомогенных реакций при постоянном объеме реакционной системы:

r= ±(1/vi) *(dci/dt), (I.5)
где знак «-» относится к исходным веществам, а знак «+» к продуктам. Величину c обычно выражают в моль/л, t - в секундах. Тогда размерность
скорости будет моль·л-1с-1. В зависимости от вида реакции и условий ее протекания применяются различные способы выражения скорости. Так, например, для топохимической реакции, в которой элементарный акт протекает на поверхности твердой фазы при одновременном изменении величины поверхности раздела фаз, скорость реакции удобно выражать через величину изменения степени превращения исходных веществ (?):

a=(n0 - nt)/n0, (I.6)

r= +da/dt = -dnt/n0dt. (I.7)
Если реакция протекает в открытой системе, в которой исходные вещества непрерывно подаются в реактор, а продукты из него выводятся, то есть, когда реакция осуществляется в потоке, ее скорость можно выразить следующим образом*:
r =-(U/V)*(c0 - c), (I.8*)
где U - объемная скорость подачи раствора исходного реагента, л/с, V - объем реактора, л, с0 и с - соответственно концентрации исходного реагента на входе в реактор и на выходе из него, моль/л.
Уравнение (I.8) легко выводится из условия материального баланса по количеству исходного реагента. Оно справедливо для так называемого стационарного режима, в котором скорость подачи в реактор исходного реагента равна скорости удаления из него продукта реакции.


Итак Для того чтобы реакция протекала слева направо, необходимо, чтобы v1 молекул реагента A1 и v2 молекул реагента A2 оказались в непосредственной близости друг с другом, так как только в этом случае станет возможен разрыв химической связи в исходных реагентах и образование молекул продуктов, то есть произойдет элементарный акт
(https://elementy.ru/images/news/heterotrophic_protocell_model_600.jpg)
Гипотетическая простейшая протоклетка, питающаяся готовой органикой. Мембрана протоклетки растет за счет включения подходящих молекул из внешней среды. Делится протоклетка простым «разваливанием пополам